View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19005_high_7 (Length: 428)
Name: NF19005_high_7
Description: NF19005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19005_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 15 - 412
Target Start/End: Complemental strand, 10029745 - 10029348
Alignment:
| Q |
15 |
gaagaagaaaaggaaaaccatggaagtcgtgttccttccaattcggcgaatccaggcttaattttaagggaattgaagcaagcgaaattgaatctaaacc |
114 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10029745 |
gaagaagaaaaggaaaaccatgggagtcgtgttccttccaattcggcgagtccaggcttaattttaagggaattgaagcaagcgaaattgaatctaaacc |
10029646 |
T |
|
| Q |
115 |
gagcaacaaacaatatcgctgatgttcgag-----gtggaatcactcaaaaagaaacttcagaaggaaattaaaggatatcactcgagaaaaccagagag |
209 |
Q |
| |
|
|| |||| || |||| ||||||||||||| |||||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
10029645 |
gaacaacgaatgatattgctgatgttcgagtttctgtggaatcactcaacaagaaacttcagaaggaaa-----gaatatcactcgagaaaaccagagag |
10029551 |
T |
|
| Q |
210 |
agttcaactcagaattcttcaaaaataacttcactagagggagagctaaaccaaacaagacttaaactgcaggtggtgaaagatgctgaaattgaatgtg |
309 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10029550 |
agtttaactcagaattcttcaaaaataacttcactagaggaagagctaaaccaaacaagacttaaactgcaggtggtgaaagatgctgaaattgaatgtg |
10029451 |
T |
|
| Q |
310 |
gttcagatgaaccttccgatattacgaaagagcttcaacgattgagttccgaggcagaacatttcaagaaaatgggagaagttgcgaaatcagaagttac |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10029450 |
gttcagatgaaccttccgatattacgaaagagcttcaacgattgagttccgaggcagaacatttcaagaaaatgggagaagttgcgaaatcagaagttac |
10029351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University