View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19005_low_20 (Length: 274)
Name: NF19005_low_20
Description: NF19005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19005_low_20 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 19 - 274
Target Start/End: Complemental strand, 47075803 - 47075548
Alignment:
| Q |
19 |
tgagatccattgggaaaacccaccacaggaacctagttagattgctgggtttttgtcatgagggttcaaaaaggcttttggtttatgaatacatgagcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47075803 |
tgagatccattgggaaaacccaccacaggaacctagttagattgctgggtttttgtcatgagggttcaaaaaggcttttggtttatgaatacatgagcaa |
47075704 |
T |
|
| Q |
119 |
cggatcacttgaaaagcttctgtttggtgatcaaagacgtccagattgggatgagagagtaagaatggcactggacattgctagagggatctcgtatctc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47075703 |
cggatcacttgaaaagcttctgtttggtgatcaaagacgtccagattgggatgagagagtaagaatggcactggacattgctagagggatctcgtatctc |
47075604 |
T |
|
| Q |
219 |
catgaagaatgtgaggcaccaatcattcattgtgacataaagcctcaaaacatttt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47075603 |
catgaagaatgtgaggcaccaatcattcattgtgacataaagcctcaaaacatttt |
47075548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 274
Target Start/End: Original strand, 47068527 - 47068782
Alignment:
| Q |
19 |
tgagatccattgggaaaacccaccacaggaacctagttagattgctgggtttttgtcatgagggttcaaaaaggcttttggtttatgaatacatgagcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47068527 |
tgagatccattgggaaaacccaccacaggaacctagttagattgcttggtttttgtgttgagggttcaaaaaggcttctggtttatgaatacatgagcaa |
47068626 |
T |
|
| Q |
119 |
cggatcacttgaaaagcttctgtttggtgatcaaagacgtccagattgggatgagagagtaagaatggcactggacattgctagagggatctcgtatctc |
218 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||| ||||||||| |||||||||||||||| |||||||| |||||||||||||||| ||||||| |
|
|
| T |
47068627 |
cggatcacttggaaagcttctttttggtgatcaaagacgcccagattggaatgagagagtaagaatagcactggatattgctagagggatcttgtatctc |
47068726 |
T |
|
| Q |
219 |
catgaagaatgtgaggcaccaatcattcattgtgacataaagcctcaaaacatttt |
274 |
Q |
| |
|
|||||||| ||||| || |||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
47068727 |
catgaagagtgtgatgctccaatcattcattgcgacttaaagcctcaaaacatttt |
47068782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 240 - 271
Target Start/End: Original strand, 3035783 - 3035814
Alignment:
| Q |
240 |
atcattcattgtgacataaagcctcaaaacat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3035783 |
atcattcattgtgacataaagcctcaaaacat |
3035814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 219 - 268
Target Start/End: Original strand, 4107407 - 4107456
Alignment:
| Q |
219 |
catgaagaatgtgaggcaccaatcattcattgtgacataaagcctcaaaa |
268 |
Q |
| |
|
|||||||| ||||| | || ||||||||||||||||||||||||||||| |
|
|
| T |
4107407 |
catgaagagtgtgacactcccatcattcattgtgacataaagcctcaaaa |
4107456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University