View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19005_low_21 (Length: 268)
Name: NF19005_low_21
Description: NF19005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19005_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 16 - 254
Target Start/End: Original strand, 7594394 - 7594632
Alignment:
| Q |
16 |
tttatatgacaatgtggtgaattatcattggatgtcgctgtaaaatggtcttacaccaacaatgcacttctattaaactcgtatgaattgatagttnnnn |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7594394 |
tttatatgacaatgtggtgacttatcattggatgtcgctgtaaaatggtcttacaccaacaatgcacttctattaaactcgtatgaattgatagttaaaa |
7594493 |
T |
 |
| Q |
116 |
nnnnnnnnnnnnntacacatgcattcatacaaactactctaagatatcactttgttatgttagatgcataaaatatttattttatcatatgtcactagat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7594494 |
aaaagtaaaaaaatacacatgcattcatacaaactactctaagatatcactttgttatgttagatgcataaaatatttattttatcatatgtcactagat |
7594593 |
T |
 |
| Q |
216 |
gcatgtgtaaacataatttatgctcacatttgaaacaat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
7594594 |
gcatgtgtaaacataatttatgctcacattagatacaat |
7594632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University