View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19005_low_25 (Length: 242)
Name: NF19005_low_25
Description: NF19005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19005_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 24066972 - 24066733
Alignment:
| Q |
1 |
tgacaatggatcaagaaatgtttatcatagaacaagagaaaaataggaatatgatgttattacaagggatgcataatgtcacggcggcttacattgccgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24066972 |
tgacaatggatcaagaaatgtttatcatagaacaagagaaaaataggaatatgatgttattacaagggatgcataatgtcacggcggcttacattgccgg |
24066873 |
T |
 |
| Q |
101 |
tggaaactgtcccccacctgctgcaaaatcttctctcgagtttgttccgcaaacaagaattaataataaatcttatccaggtacatcctatatcgataat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24066872 |
tggaaactgtcccccacctgctgcaaaatcttctcccgagtttgttctgcaaacaagaattaataataaatcttatccaggtacatcctatatcgataat |
24066773 |
T |
 |
| Q |
201 |
tcattctattttatgttccaatatatatgcggttcctatg |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24066772 |
tcattctatttcatgttccaatatatatgcggttcctatg |
24066733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University