View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19005_low_27 (Length: 240)
Name: NF19005_low_27
Description: NF19005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19005_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 30511822 - 30512043
Alignment:
| Q |
1 |
ttctatgtcaactttaacaggctagtttgacttcttnnnnnnntatttatttttgtttttcttccttgccacatgtcaatcgtccattggatgctaatgt |
100 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
30511822 |
ttctatgtcaactttagcaagctagtttgacttcttaaaaaaatgtttatttttgtttttcttccttgccacatgtcagtcgtccattggacgctaatgt |
30511921 |
T |
 |
| Q |
101 |
ggcactgatgatgtagcaactctgccattcgacaaggttcaatcatcatgatttcttcctcgtgggtagattagtatgacttggatatcacatgaaccag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| | |
|
|
| T |
30511922 |
ggcactgatgatgtagcaactctgccattcggcaaggttcaatcatcatgatttcttcctcgtaagtagattagtatgacttgtatatcacatgaacctg |
30512021 |
T |
 |
| Q |
201 |
aagtgatgaattcttagtttgt |
222 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
30512022 |
aagtgatgaaatcttagtttgt |
30512043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 94
Target Start/End: Original strand, 30532733 - 30532777
Alignment:
| Q |
50 |
tttttgtttttcttccttgccacatgtcaatcgtccattggatgc |
94 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
30532733 |
tttttgtttttcttccttgccacatgtcagtctcccattggatgc |
30532777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University