View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19005_low_34 (Length: 215)
Name: NF19005_low_34
Description: NF19005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19005_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 50958230 - 50958032
Alignment:
| Q |
1 |
ctagtatgaataagaacaaaacaacaagcttaaatttgcataaactattgatcatagcatgtttatgtagattaaattaaaaatactgttgctggaaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50958230 |
ctagtatgaataagaacaaaacaacaagcttaaatttgcataaactagtgatcatagcatgtttatgtagattatattaaaaatactgttgctggaaatt |
50958131 |
T |
 |
| Q |
101 |
ttccctcccccttccattccttctacggttacggcgacgaccccctcttgcagccttcccaaattgatcacactttgtaaatatcccttggtccttctt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50958130 |
ttccctcccccttccattccttctacggttacggcgatgaccccctcttgcagccttcccaaattgatcacactttgtaaatatcccttggtccttctt |
50958032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 71 - 129
Target Start/End: Complemental strand, 15856404 - 15856346
Alignment:
| Q |
71 |
attaaattaaaaatactgttgctggaaattttccctcccccttccattccttctacggt |
129 |
Q |
| |
|
|||| |||||||| |||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
15856404 |
attatattaaaaagactgttgctggagttttcccctcccccttacattccttctacggt |
15856346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 47
Target Start/End: Complemental strand, 15856500 - 15856458
Alignment:
| Q |
5 |
tatgaataagaacaaaacaacaagcttaaatttgcataaacta |
47 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
15856500 |
tatgaataagaacaaaacgacaagcttaaagttgcataaacta |
15856458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 142 - 189
Target Start/End: Complemental strand, 8155381 - 8155334
Alignment:
| Q |
142 |
cccctcttgcagccttcccaaattgatcacactttgtaaatatccctt |
189 |
Q |
| |
|
||||||||||||||||| ||||| |||||| ||||||||||||||||| |
|
|
| T |
8155381 |
cccctcttgcagccttcacaaatcgatcactctttgtaaatatccctt |
8155334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University