View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19005_low_9 (Length: 395)
Name: NF19005_low_9
Description: NF19005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19005_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 8 - 335
Target Start/End: Complemental strand, 5256878 - 5256552
Alignment:
| Q |
8 |
agataatactcaaatggcatatgatttaattgcttgtgaagtatcaaacaattttgttatatatatcacttagctttaacatgtcattgcaatttgcata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5256878 |
agataatactcaaatggcatatgatttaattgcttgtgaagtatcaaacaattttgttatatatatcacttagctttaacatgtcattgcaatttgcata |
5256779 |
T |
 |
| Q |
108 |
tgaaattcatttccaaacaagtatatcaaagatattctgatactggtcaattttttgtgtaattcaatgtacttattgtaagtattcaattttagaaaaa |
207 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5256778 |
tgaaattcatttccaaa-aagtatatcaaagatattctgatactggtcacttttttgtgtcattcaatgtacttattgtaagtattcaattttagaaaaa |
5256680 |
T |
 |
| Q |
208 |
ttaaatcaaatctataacataaatatcttacccttttatgcagctctgagatggattgattcataacttggttctgcaaaaatcatattgatcagttaat |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5256679 |
ttaaatcaaatctataacataaatatcttacccttttatgcagctctgagatggattgattcataacttggttctgcaaaaatcatattgatcagttaat |
5256580 |
T |
 |
| Q |
308 |
tgatcctcagctgaaaaatcaaatgtta |
335 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5256579 |
tgatcctcagctgaaaaatcaaatgtta |
5256552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University