View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19007_high_28 (Length: 290)
Name: NF19007_high_28
Description: NF19007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19007_high_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 253
Target Start/End: Complemental strand, 49372891 - 49372654
Alignment:
| Q |
16 |
atagcttgtgataagtcttgtgagnnnnnnnnccttacgagaagataagtcgagtatgggacttttcaaacaaaatggtgccctgtagaaccgtgccatg |
115 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49372891 |
atagcttgtgataagtcttgtgagaaaaaaaatcttacgagaagataagtcgagtatgggacttttcaaacaaaatggtgccctgtaaaaccgtgccatg |
49372792 |
T |
|
| Q |
116 |
cccgctcaaattccgttatcgatatcaaaatctcaataatttgaaaataatattgtcggcatttctctaaaagacaaaacttatgtacaattttttaagt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49372791 |
cccgctcaaattccgttatcgatatcaaaatctcaataatttgaaaataatattgtcggcatttctctaaatgacaaaacttatgtacaattttttaagt |
49372692 |
T |
|
| Q |
216 |
cttttcgttgctgccaaaaatatttatatagttataac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49372691 |
cttttcgttgctgccaaaaatatttatatagttataac |
49372654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University