View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19007_high_29 (Length: 280)
Name: NF19007_high_29
Description: NF19007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19007_high_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 8008319 - 8008584
Alignment:
| Q |
1 |
tgtggctccgaaaccatggtgggagggtatccttactgctgtcgtgactgatcaaggacgacattaactgcattccaatcatccattactttacattttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8008319 |
tgtggctccgaaaccatggtgggagggtgtccttactgctgtcatgactgatcaaggacgacattaactgcattccaatcatccattactttacactttt |
8008418 |
T |
|
| Q |
101 |
taacgaccacttaagcgcatacctcattcacattctgccaaagtgctaagttgtggtgcttccaaatgctccaaataataataaccatctgatgtcgcag |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8008419 |
tatcgaccacttaagcgcatacctcattcacattctgccaaagtgctaagttgtggtgcttccaaatgcttcaaataataataaccatctgatgtcgcag |
8008518 |
T |
|
| Q |
201 |
ttcaggtgcaagactttatagtagggagaaaatagcagcggttgctgaggcattggtggtgagagt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8008519 |
ttcaggtgcaagactttatagtagggagaaaatagcagcggttgctgaggcattggtggtgagagt |
8008584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University