View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19007_high_31 (Length: 261)
Name: NF19007_high_31
Description: NF19007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19007_high_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 7560880 - 7560630
Alignment:
| Q |
1 |
caataaaccccatcatcattgtaacccatgggcatgcatcattcaagaaagaacgaaacagagaaaatgcaaataaacatgtatataccattaccaaggc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
7560880 |
caataaaccccatcatcattgtaacccatggacatgcatcattcaagaaagaacgaaacagagaaaatgcaaataaacttgtacataccattaccaaggc |
7560781 |
T |
|
| Q |
101 |
gggatgagcatgcagtggaatcgggaaggtaatctggtggttctggccggagaattggtttcggggttagttggatagggaagttgagaaccccttgctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
7560780 |
gggatgagcatgcagtggaatcgggaaggtaatctggtggttctggccggagaattggtttcggggttagttggatagggaagttgaaatccccttgctt |
7560681 |
T |
|
| Q |
201 |
ggtaaacagtgaaaactccttcatctggtgccaataatgttggagtctgtg |
251 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7560680 |
ggtaaacagcgaaaactccttcatctggtgccaataatgttggagtctgtg |
7560630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University