View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19007_high_32 (Length: 256)
Name: NF19007_high_32
Description: NF19007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19007_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 8008237 - 8007979
Alignment:
| Q |
1 |
caagtataggtatttgtgttcatgatgaggatggaacttatgtcttggccaagactttgagcattacacccatgacttctacatatgttggtgaggccct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
8008237 |
caagtataggtatttgtgttcatgatgaggatggaacttatgtcttggccaagactttgagcattacgcccatgacttctacatatgttagtgaggccct |
8008138 |
T |
 |
| Q |
101 |
tggcttgttctatgtgctccagtggctgcacgatatgcatatggatagtgttgatttc-----------gtagacgacaactgatgctttaaaatcaata |
189 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8008137 |
tggcttattttatgtgctccagtggctgcacgatatgcgtatggatagtgttgatttcgtggtgaatttgtagacgacaactgatgctttaaaatcaata |
8008038 |
T |
 |
| Q |
190 |
cgtaccaatgttatagaatttggccagattatcacgtcatgtcagtctttgttcttctc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8008037 |
cgtaccaatgttatagaatttggccagattatcacgtcatgtcggtctttgttcttctc |
8007979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University