View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19007_high_38 (Length: 248)
Name: NF19007_high_38
Description: NF19007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19007_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 7560886 - 7561122
Alignment:
| Q |
1 |
taaaacacagattttgcattttgccattttgggggaagtagatcctgggtttagcgcgaaatgtcacctcgtggcttaggctctcagcgaaaacgctaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
7560886 |
taaaacacagattttgcattttgccattttgggggaagtagatcctggttttagcgcgaaatgtcacctcgtggcttaggctctcaactaaaacgctaat |
7560985 |
T |
 |
| Q |
101 |
tgttatgacttagttcccgaggagaactcaatccaaaagactaatccatcagtaacaaactcaacttccatttctactcattgtgtcactaattatcatt |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7560986 |
tgttatgacttagttcacgaggagaactcaatccaaaagactaatccatcagtaacaaactgaacttccatttctactcattgtgtcactaattatcatt |
7561085 |
T |
 |
| Q |
201 |
gttttcaaacaaactcaacatctttatgttaatattg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7561086 |
gttttcaaacaaactcaacatctttatgttaatattg |
7561122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University