View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19007_high_40 (Length: 241)
Name: NF19007_high_40
Description: NF19007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19007_high_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 39866018 - 39865794
Alignment:
| Q |
1 |
atggacatcattgttttaaatacactatataattagaaacatataaagtattagtatactgtctttgtgtaattgtgttcctactccattctggcagtcc |
100 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39866018 |
atggacatcattgtttcaaatacattatataattagaaacatagaaagtattagtatactgtctttgtgtaattgtgttcctactccattctggcagtcc |
39865919 |
T |
|
| Q |
101 |
taactcacaggcttgtttaacaaagcagttcactgcaatcacagcttgcactcaatgtctctctcttctgcatcaataggtctgcaattgtactttcatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
39865918 |
taactcacaggcttgtttaacaaagcagttcactgcaatcacagcttgcactcaatgtctctctcttctgcatcaataggtctgcaattgtactttaatt |
39865819 |
T |
|
| Q |
201 |
ttttatatcaaatacacgtccatct |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39865818 |
ttttatatcaaatacacgtccatct |
39865794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University