View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19007_high_46 (Length: 226)
Name: NF19007_high_46
Description: NF19007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19007_high_46 |
 |  |
|
| [»] scaffold0101 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0101 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: scaffold0101
Description:
Target: scaffold0101; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 800 - 1019
Alignment:
| Q |
7 |
ctaactctattaatttggggattgtgaaattcaattaatttgtttgtgaattgctgattgcgatggatttttgagttcgcttgaatacatgtgttctccg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
800 |
ctaactctattaatttggggattgtgaaattcaattaatttgtttatgaattgccgattgcgatggatttttgagttcgcttgaatacatgtgttctccg |
899 |
T |
 |
| Q |
107 |
aaaaccattgctatttataattaaatttaattgatccttaacatgatttggcaatgataccgagtaattatgttcctgacatattgatacttgtgtgcta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
900 |
aaaaccattgctatttataattaaatttaattgatccttaacatgatttggcaatgataccaagtaattatgttcctgacatattgatacttgtgtgcta |
999 |
T |
 |
| Q |
207 |
cttattgttattttattact |
226 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1000 |
cttattgttattttattact |
1019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University