View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19007_high_47 (Length: 224)

Name: NF19007_high_47
Description: NF19007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19007_high_47
NF19007_high_47
[»] chr5 (1 HSPs)
chr5 (16-162)||(5734113-5734259)


Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 16 - 162
Target Start/End: Original strand, 5734113 - 5734259
Alignment:
16 aaaatatcaatgtactaacgaacaaaactttaatcaagaacttattttaatgatttaatgacaaaaatgcaaaaacatattttattgatcaatttacttt 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5734113 aaaatatcaatgtactaacgaacaaaactttaatcaagaacttattttaatgatttaatgacaaaaatgcaaaaacatattttattgatcaatttacttt 5734212  T
116 tacacatctctttataactcatgtatccagaaaattgcttccttcaa 162  Q
    ||||||||||||||||||||||||||| || ||||||||||||||||    
5734213 tacacatctctttataactcatgtatcaagtaaattgcttccttcaa 5734259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University