View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19007_high_47 (Length: 224)
Name: NF19007_high_47
Description: NF19007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19007_high_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 16 - 162
Target Start/End: Original strand, 5734113 - 5734259
Alignment:
| Q |
16 |
aaaatatcaatgtactaacgaacaaaactttaatcaagaacttattttaatgatttaatgacaaaaatgcaaaaacatattttattgatcaatttacttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5734113 |
aaaatatcaatgtactaacgaacaaaactttaatcaagaacttattttaatgatttaatgacaaaaatgcaaaaacatattttattgatcaatttacttt |
5734212 |
T |
|
| Q |
116 |
tacacatctctttataactcatgtatccagaaaattgcttccttcaa |
162 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
5734213 |
tacacatctctttataactcatgtatcaagtaaattgcttccttcaa |
5734259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University