View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19007_high_49 (Length: 212)
Name: NF19007_high_49
Description: NF19007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19007_high_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 14 - 195
Target Start/End: Complemental strand, 48999851 - 48999670
Alignment:
| Q |
14 |
agaatatcttgccttctactttctttctgctcgtgatgctcctgagctattcacaagcataaaatcaaccttcccttatctaaacatgacgatttatcac |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| || ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48999851 |
agaaaatcttgccttctactttctttctgctcatggtgctcctgaactattcacaagcataaaatcaaccttcccttatctaaacatgacgatttatcac |
48999752 |
T |
 |
| Q |
114 |
tttaattctgatcgtgttcgcggtaagatatcaaagtccattagaaaagcattggatcaacctttgaattatgcaaggatat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48999751 |
tttaattctgatcgtgttcgcggtaagatatcaaagtccattagaaaagcattggatcaacctttgaattatgcaaggatat |
48999670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University