View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19007_low_20 (Length: 358)
Name: NF19007_low_20
Description: NF19007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19007_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 357
Target Start/End: Complemental strand, 38609171 - 38608806
Alignment:
| Q |
1 |
tcgtcagtttatcaagttatatgaggcacattgctctttgtttgtgtgtcatatattattcgtaggttcaggtatcgttcaaagtactgtcacaatatgg |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38609171 |
tcgtcagtttatcaagttatatgagtcacattgctctttgtttgtgtgtcatatattatttgtaggttcaggtatcgttcaaagtactgtcacaatatgg |
38609072 |
T |
 |
| Q |
101 |
tttgttatactt-ttgcaaatgatactcgtgttttggtgacattttggtatgcattggcaaataagggtcttgttgatta--------gctctctatgga |
191 |
Q |
| |
|
||||| ||||| |||| ||||||||||||| |||||||||||||||||||| |||||||||||||||| |||||||||| ||||| |||||| |
|
|
| T |
38609071 |
tttgtgatactgattgccaatgatactcgtgctttggtgacattttggtatgtattggcaaataagggttttgttgattatttgattagctctgtatgga |
38608972 |
T |
 |
| Q |
192 |
tatgctacgttgttcnnnnnnncctagtagttatttattctcatatcgtttcttaggttgcatatattgagggtgacttgtttaaaccgaacactgtatg |
291 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38608971 |
tatgctacgttgttctttttttcctagtagttatttattctcatatcgtttcttaggttgcatatattgagggtgacttgtttaaaccgaacaatgtatg |
38608872 |
T |
 |
| Q |
292 |
ttctagttaggttgcatgtgatgaggctggctggcttgtttaaactaaggaatgtacgttctagtt |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38608871 |
ttctagttaggttgcatgtgatgaggctggctggcttgtttaaactaaggaatgtacgttctagtt |
38608806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University