View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19007_low_43 (Length: 250)
Name: NF19007_low_43
Description: NF19007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19007_low_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 28195831 - 28196071
Alignment:
| Q |
1 |
ccatcgtgtcctcataaatgtttgtaaagcccagcccacaaaaacgttgaagttgaatttacaggattaattactttcagcaccccccaaaaaattccgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28195831 |
ccatcgtgtcctcataaatgtttgtaaagcccagcccacaaaaacattgaagttgaatttacaggattaattactttcagc-ccccccaaaaaattccgt |
28195929 |
T |
|
| Q |
101 |
agataattttttccattaacattgatatacacatcccactaattcaaaatacaaaaacctctcattgatgtcacacaacattaacaactcatttacacat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28195930 |
agataattttttccattaacattgatatacacatcccactaattcaaaatacaaaaacctctcatagatgtcacacaacattaacaactcatttacacat |
28196029 |
T |
|
| Q |
201 |
accttacttcgttttttcatctccttctcatgtgcctttgct |
242 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28196030 |
accttacatcgttttttcatctccttctcatgtgcctttgct |
28196071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University