View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19007_low_51 (Length: 233)
Name: NF19007_low_51
Description: NF19007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19007_low_51 |
 | |
|
| [»] chr1 (4 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 163 - 233
Target Start/End: Original strand, 13789512 - 13789582
Alignment:
| Q |
163 |
ttgcttactttaattggaacagctagcaaaggttgagccttctccaaagtaagtccaaatttatcatccat |
233 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13789512 |
ttgcttactttaattggaacaactagcaaaggttgagccttctccaaagtaagttcaaatttatcatccat |
13789582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 13785892 - 13785947
Alignment:
| Q |
1 |
tcatttttacattgccttcttatgatgtcacttacattctcactagtcactacatt |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13785892 |
tcatttttacattgccttcttatgatgtcacttacattctcactagtcactacatt |
13785947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 167 - 233
Target Start/End: Original strand, 13794579 - 13794645
Alignment:
| Q |
167 |
ttactttaattggaacagctagcaaaggttgagccttctccaaagtaagtccaaatttatcatccat |
233 |
Q |
| |
|
||||||||||||||||| |||| | ||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
13794579 |
ttactttaattggaacaactagaacaggttgagcattctccaaagtaagttcaaatttatcatccat |
13794645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 123 - 163
Target Start/End: Original strand, 13786014 - 13786054
Alignment:
| Q |
123 |
tacgtaaaatatttattttgtcacataaaccattcaattat |
163 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13786014 |
tacgtaaaatatttattttgtcacatgaaccattcaattat |
13786054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University