View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19008_low_2 (Length: 344)
Name: NF19008_low_2
Description: NF19008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19008_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-115; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 101 - 327
Target Start/End: Complemental strand, 32251368 - 32251142
Alignment:
| Q |
101 |
aagcatataactgattgctcaaaagacttcttgaacacactttatatgtaagtttatagaagttgtgtaacttggactttcgaataaccctagacgttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32251368 |
aagcatataactgattgctcaaaagacttcttgaacacacttgatatgtaagtttatagaagttgtgtaacttggactttcgaataaccctagacgttga |
32251269 |
T |
 |
| Q |
201 |
tttttgaaaatctttttcgaaatagtagtcttcgaacttttggcttgttctcaattttgaaacgagaggctacccctgcaatgagattaatcctgataca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32251268 |
tttttgaaaatctttttcgaaatagtagtcttcgaacttttggcttattctcaattttgaaacgagaggctacccctgctatgagattaatcctgataca |
32251169 |
T |
 |
| Q |
301 |
gttgcaaatagattaaaacaacaggag |
327 |
Q |
| |
|
|||||||||||||||| |||||||||| |
|
|
| T |
32251168 |
gttgcaaatagattaatacaacaggag |
32251142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 101 - 252
Target Start/End: Complemental strand, 32246285 - 32246137
Alignment:
| Q |
101 |
aagcatataactgattgctcaaaagacttcttgaacacactttatatgtaagtttatagaagttgtgtaacttggactttcgaataaccctagacgttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| | || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32246285 |
aagcatataactgattgctcaaaagacttcctgaacatagttgatatgaaagtttatagaagttgtgtaacttggactttcgaataaccctagacgttga |
32246186 |
T |
 |
| Q |
201 |
tttttgaaaatctttttcgaaatagtagtcttcgaacttttggcttgttctc |
252 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
32246185 |
tttttgaaaatc---ttcgaaatagcagtcttcgaacttctggcttgttctc |
32246137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 32251514 - 32251424
Alignment:
| Q |
12 |
atgaactcatttacatagagtttgattatacaatttatagactaagaaataaattaatctccaacacatgtcgatgtcatgtgtcttctaa |
102 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32251514 |
atgaactcatttacatggagtttgattatacaatttatagactaagaaataaattaatctctaacacatgtcgatgtcatgtgtcttctaa |
32251424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 32246431 - 32246341
Alignment:
| Q |
12 |
atgaactcatttacatagagtttgattatacaatttatagactaagaaataaattaatctccaacacatgtcgatgtcatgtgtcttctaa |
102 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |||| ||| ||||||| ||||||||||| |
|
|
| T |
32246431 |
atgaactcatttacatggagtttgattatacaatttatggactaagaaataaattaatctgtaacatgtgtggatgtcacgtgtcttctaa |
32246341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 281 - 327
Target Start/End: Complemental strand, 32245496 - 32245450
Alignment:
| Q |
281 |
atgagattaatcctgatacagttgcaaatagattaaaacaacaggag |
327 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32245496 |
atgagtttagtcctgatacagttgcaaatagattaaaacaacaggag |
32245450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 257 - 288
Target Start/End: Complemental strand, 32256472 - 32256441
Alignment:
| Q |
257 |
ttgaaacgagaggctacccctgcaatgagatt |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32256472 |
ttgaaacgagaggctacccctgcaatgagatt |
32256441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 254 - 288
Target Start/End: Complemental strand, 32246066 - 32246032
Alignment:
| Q |
254 |
attttgaaacgagaggctacccctgcaatgagatt |
288 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32246066 |
attttcaaacgagaggctacccctgcaatgagatt |
32246032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 12 - 64
Target Start/End: Original strand, 10191254 - 10191306
Alignment:
| Q |
12 |
atgaactcatttacatagagtttgattatacaatttatagactaagaaataaa |
64 |
Q |
| |
|
|||||||| ||| ||| |||||||||| || |||||||||||||| ||||||| |
|
|
| T |
10191254 |
atgaactcttttgcatcgagtttgattttataatttatagactaacaaataaa |
10191306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University