View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19009_high_24 (Length: 382)
Name: NF19009_high_24
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19009_high_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 10 - 363
Target Start/End: Complemental strand, 22586416 - 22586062
Alignment:
| Q |
10 |
agaagaaacaa-gtattgcataacaaccacctcttcatatatctactccactctttcatatctcattagcctattatatctttacttcacctaaattcat |
108 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22586416 |
agaagaaacaaagtattgcataacaaccacctcttcatatatctactccactctttcatatctcattagcctattatatctttacttcacctaaattcat |
22586317 |
T |
|
| Q |
109 |
atttcaattatactattttctctttaaagcataataaatatgattgactcatccatgtcaaagacaatgatggagaaaataatgtcttctaattggtcag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22586316 |
atttcaattatactattttctctttaaagcctaataaatatgattgactcatccatgtcaaagacaatgatggagaaaataatgtcttctaattggtcag |
22586217 |
T |
|
| Q |
209 |
agaatgatgaacttttaagagagcttttagttgatgagactcctcttcttatgttgccacatgagagagtatctgaagtagccaatttaagtcatgaatc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
22586216 |
agaatgatgaacttttaagagagcttttagttgatgagtctcctcttcttatgttgccacatgagagagtatctgaagtagccaatttaagtcatgattc |
22586117 |
T |
|
| Q |
309 |
ttcaaaagaccaagcttttaataggttcatttcaaatatttattcaggtcctacc |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22586116 |
ttcaaaagaccaagcttttaataggttcatttcaaatatttattcaggtcctacc |
22586062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University