View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19009_high_43 (Length: 342)
Name: NF19009_high_43
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19009_high_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 3 - 328
Target Start/End: Original strand, 38666718 - 38667043
Alignment:
| Q |
3 |
cgagtgagaagaaatctttgagtgttcgttttgctttgaggagattcttgcttggagcttcgtgtttagggttttgatttctggcggagatttggaagtg |
102 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38666718 |
cgagagaggagaaatctttgagtgttcgttttgctttgaggagattcttgcttggagcttcgtgtttagggttttgatttctggcggagatttggaagtg |
38666817 |
T |
 |
| Q |
103 |
gtggagaagtcgaggggcggcggtggccaccgtgcgttggtggcggatgatggagaatgatgcgagcgacatcttgaaggagagagagaattgagatttc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38666818 |
gtggagaagtcgaggggcggcggtggccaccgtgcgttggtggcggatgatggagaatgatgcgagcgacatcttgaaggagagagagaattgagatttc |
38666917 |
T |
 |
| Q |
203 |
aaagccttttttgaaacggnnnnnnnctgttatgagttcatttctcaagtgtgagggatagagcgagcgagagaggaatgttattcgtgactggcttttg |
302 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38666918 |
aaagccttttttgaaacggtttttttctgttatcagttcatttctcaagtgtgagggacagcgcgagcgagagaggaatgttattcgtgactggcttttg |
38667017 |
T |
 |
| Q |
303 |
ctaaacgacattttgccggtttaaac |
328 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
38667018 |
ctaaacgacattttgccggtttaaac |
38667043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University