View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19009_high_62 (Length: 282)
Name: NF19009_high_62
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19009_high_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 5129754 - 5129589
Alignment:
| Q |
1 |
tttgatgaaagagtacaactgaaatgaagcaacttccatacaataggtagggttatgaaagttcttgttttaggatgcaaatgatgtcttttctttttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
5129754 |
tttgatgaaagagtacaactgaaatgaagcaacttccatacaataggtagggttatgaaagttcttgttttaggatgaaaatgatgtcttttcttttt-t |
5129656 |
T |
 |
| Q |
101 |
tgtaaaatttaatctctgttcattagtcattatctatggttttcggagaatgacttgctaccttgtt |
167 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5129655 |
tgtaaactttaatctctgttcattagtcattatctatggttttcagagaatgacttgctaccttgtt |
5129589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 196 - 237
Target Start/End: Complemental strand, 5129567 - 5129526
Alignment:
| Q |
196 |
tttatcattcagtttcctgatgtcttatatatgcttttcttc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5129567 |
tttatcattcagtttcctgatgtcttatatatgcttttcttc |
5129526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University