View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19009_high_76 (Length: 249)

Name: NF19009_high_76
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19009_high_76
NF19009_high_76
[»] chr3 (4 HSPs)
chr3 (1-108)||(7297578-7297685)
chr3 (169-234)||(7297452-7297517)
chr3 (196-234)||(7306547-7306585)
chr3 (69-108)||(7306715-7306754)


Alignment Details
Target: chr3 (Bit Score: 87; Significance: 8e-42; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 7297685 - 7297578
Alignment:
1 tcatcaaatgatctcatgagtgatgatgaaagctggtggaaggagaattggtcgcctcaacnnnnnnntaaatttgcaatcaaaatgtctgattttgagg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||    
7297685 tcatcaaatgatctcatgagtgatgatgaaagctggtggaaggagaattggtcgcctcaacaaaaaaataaatttgcaatcaaaatgtctgattttgagg 7297586  T
101 tgctctag 108  Q
    ||||||||    
7297585 tgctctag 7297578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 169 - 234
Target Start/End: Complemental strand, 7297517 - 7297452
Alignment:
169 ccatcccctctaagcctttttctatgttacaggaagcaatcaaaatggtacaaccttcgttaacaa 234  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7297517 ccatcccctctaagcctttttctatgttacaggaagcaatcaaaatggtacaaccttcgttaacaa 7297452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Complemental strand, 7306585 - 7306547
Alignment:
196 tacaggaagcaatcaaaatggtacaaccttcgttaacaa 234  Q
    |||||||||||||||||||||||||||||||||||||||    
7306585 tacaggaagcaatcaaaatggtacaaccttcgttaacaa 7306547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 69 - 108
Target Start/End: Complemental strand, 7306754 - 7306715
Alignment:
69 taaatttgcaatcaaaatgtctgattttgaggtgctctag 108  Q
    ||||||||||||||||||||| ||||||||||||||||||    
7306754 taaatttgcaatcaaaatgtccgattttgaggtgctctag 7306715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University