View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19009_high_76 (Length: 249)
Name: NF19009_high_76
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19009_high_76 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 8e-42; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 7297685 - 7297578
Alignment:
| Q |
1 |
tcatcaaatgatctcatgagtgatgatgaaagctggtggaaggagaattggtcgcctcaacnnnnnnntaaatttgcaatcaaaatgtctgattttgagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7297685 |
tcatcaaatgatctcatgagtgatgatgaaagctggtggaaggagaattggtcgcctcaacaaaaaaataaatttgcaatcaaaatgtctgattttgagg |
7297586 |
T |
 |
| Q |
101 |
tgctctag |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
7297585 |
tgctctag |
7297578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 169 - 234
Target Start/End: Complemental strand, 7297517 - 7297452
Alignment:
| Q |
169 |
ccatcccctctaagcctttttctatgttacaggaagcaatcaaaatggtacaaccttcgttaacaa |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7297517 |
ccatcccctctaagcctttttctatgttacaggaagcaatcaaaatggtacaaccttcgttaacaa |
7297452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 196 - 234
Target Start/End: Complemental strand, 7306585 - 7306547
Alignment:
| Q |
196 |
tacaggaagcaatcaaaatggtacaaccttcgttaacaa |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7306585 |
tacaggaagcaatcaaaatggtacaaccttcgttaacaa |
7306547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 69 - 108
Target Start/End: Complemental strand, 7306754 - 7306715
Alignment:
| Q |
69 |
taaatttgcaatcaaaatgtctgattttgaggtgctctag |
108 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7306754 |
taaatttgcaatcaaaatgtccgattttgaggtgctctag |
7306715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University