View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19009_high_79 (Length: 246)

Name: NF19009_high_79
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19009_high_79
NF19009_high_79
[»] chr6 (1 HSPs)
chr6 (16-227)||(6186546-6186757)
[»] chr8 (1 HSPs)
chr8 (16-224)||(4243493-4243701)


Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 16 - 227
Target Start/End: Complemental strand, 6186757 - 6186546
Alignment:
16 acatcatcgatcggaaaagttggtttggttgtcgcgtttttagtcttggttgttttattgattcgatatttcaccggtaacacaaagactgataacggag 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||| |||||||||||||||| || ||||||||||||  |||||    
6186757 acatcatcgatcggaaaagttggtttggttgtcgcgtttttagtcctggttgttctcttggttcgatatttcaccgggaatacaaagactgatgccggag 6186658  T
116 ttagagaattcaacggtagaaagactagtttcgacgatgtgatgaatgcgattattggaattattgctgatgctgttactattgttgttgttgcaattcc 215  Q
    ||||||||||||| ||||||||||| ||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
6186657 ttagagaattcaatggtagaaagacgagttttgatgatgtgatgaatgcaattattggaattattgctgatgctgttactattgttgttgttgcaattcc 6186558  T
216 tgagggtttgcc 227  Q
    ||||||||||||    
6186557 tgagggtttgcc 6186546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 16 - 224
Target Start/End: Complemental strand, 4243701 - 4243493
Alignment:
16 acatcatcgatcggaaaagttggtttggttgtcgcgtttttagtcttggttgttttattgattcgatatttcaccggtaacacaaagactgataacggag 115  Q
    ||||| || |||||||| |||||||||| |||||| ||||||||| | |||||| | |||||||||||||||||||| ||||||||||||||||||||||    
4243701 acatcctcaatcggaaaggttggtttggctgtcgcatttttagtccttgttgttctgttgattcgatatttcaccgggaacacaaagactgataacggag 4243602  T
116 ttagagaattcaacggtagaaagactagtttcgacgatgtgatgaatgcgattattggaattattgctgatgctgttactattgttgttgttgcaattcc 215  Q
    ||||||| |||||||||||||||||||||||||| ||||||||||||||  |||||||||||||||||||||||||||||||||| |||||||| || ||    
4243601 ttagagagttcaacggtagaaagactagtttcgatgatgtgatgaatgcagttattggaattattgctgatgctgttactattgtcgttgttgctatccc 4243502  T
216 tgagggttt 224  Q
     ||||||||    
4243501 cgagggttt 4243493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University