View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19009_high_80 (Length: 242)
Name: NF19009_high_80
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19009_high_80 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 6485196 - 6485113
Alignment:
| Q |
1 |
cagtcttaataagagaaactaattatttgggccttgtttatctggtccaatttgatgctactgccacgtctccttgtgggatga |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6485196 |
cagtcttaataagagaaactaattatttgggccttgtttatctggtccaatttgatgctactgccacgtctccttgtgagatga |
6485113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 157 - 228
Target Start/End: Complemental strand, 6485040 - 6484969
Alignment:
| Q |
157 |
actttgattgatggtttttgtaaagctgggacaggcaagttggaagattatgatctttatttatgtaatata |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6485040 |
actttgattgatggtttttgtaaagctgggacaggcaagttggaagattatgatctttatttatgtaatata |
6484969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University