View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19009_high_86 (Length: 234)
Name: NF19009_high_86
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19009_high_86 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 24 - 163
Target Start/End: Original strand, 29061483 - 29061621
Alignment:
| Q |
24 |
aaagcaatcaaaacactttcaaggatcatcattactctctttattcttgactttgacaatatcaagcagtgcgggtaactacatcttatatctattggcc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
29061483 |
aaagcaatcaaaacactttcaaggatcatcattactctctttattctttactttgacaatatcaagcagtgcgggtaactacatc-tatatccattggcc |
29061581 |
T |
|
| Q |
124 |
attcatagtgcctcagaagtatacacccaattgagaaatt |
163 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29061582 |
attcatagtgcctcagaagtatacgcccaattgagaaatt |
29061621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 29061645 - 29061695
Alignment:
| Q |
184 |
ctttttagattatctttgcatgacttaagaccgcaaatttgaatttcatct |
234 |
Q |
| |
|
||| |||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
29061645 |
cttcttagattatctttgcatgtcttaggaccgcaaatttgaatttcatct |
29061695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University