View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19009_high_89 (Length: 227)

Name: NF19009_high_89
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19009_high_89
NF19009_high_89
[»] chr5 (1 HSPs)
chr5 (128-180)||(10094422-10094474)


Alignment Details
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 128 - 180
Target Start/End: Complemental strand, 10094474 - 10094422
Alignment:
128 tgaaaatagtaaaataaaaccatatattatattgtccaatgaacatcaatatg 180  Q
    |||||||||||||||||||||||||||| ||||| | ||||||||| ||||||    
10094474 tgaaaatagtaaaataaaaccatatattctattggcaaatgaacataaatatg 10094422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University