View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19009_low_10 (Length: 503)
Name: NF19009_low_10
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19009_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 454; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 454; E-Value: 0
Query Start/End: Original strand, 18 - 479
Target Start/End: Original strand, 47558928 - 47559389
Alignment:
| Q |
18 |
gtgaacgtcgtaaaccgctacggatgcatctgatgcagcagataacaaatatcttccttcagttaaatcaatttgaagggaattaatggaacctttgtga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47558928 |
gtgaacgtcgtaaaccgctacggatgcatctgatgcagcagataacaaatatcttccttcagttaaatcaatttgaagggaattaatggaacctttgtga |
47559027 |
T |
|
| Q |
118 |
ggggaaacgagttctttgtgatttgataactcgagttgtgaaattcgatttgattttatgcgattagcgaaggaatttggacgcaattttccggattctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47559028 |
ggggaaacgagttctttgtgatttgataactcgagttgtgaaattcgatttgattttatgcgattagcgaaggaatttggacgcaattttccggattctc |
47559127 |
T |
|
| Q |
218 |
tgtctttgatgttcttccacgtatccatattcggagcatctttgaatttttggagttcgatttcaatttcaatcagtaacaaaggttgttgctatctctg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47559128 |
tgtctttgatgttcttccacgtatccatattcggagcatctttgaatttttggagttcgatttcaatttcaatcagtaacaaaggttgttgctatctctg |
47559227 |
T |
|
| Q |
318 |
gtgagtggtgatactacggccacaaccaaagtcgtcttcttcctcctccttcactcctggaactcaagtggactcaaatgggcttgtttcatccacttag |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47559228 |
gtgagtggtgatactacggccacaaccaaagtcgtcttcttcctcctccttcactcctggaactcaagtggactcaaatgggcttgtttcatccacttcg |
47559327 |
T |
|
| Q |
418 |
tattggacttcaattcctatgggcttaactccgctccgcattttgaattctgctcttctctc |
479 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47559328 |
tattggacttcaattcctatgggcttaactcggctccgcattttgaattctgctcttctctc |
47559389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 49 - 87
Target Start/End: Complemental strand, 44869391 - 44869353
Alignment:
| Q |
49 |
gatgcagcagataacaaatatcttccttcagttaaatca |
87 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44869391 |
gatgcagcagataacaaatatcttccttctgttaaatca |
44869353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University