View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19009_low_32 (Length: 367)
Name: NF19009_low_32
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19009_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 19 - 348
Target Start/End: Original strand, 36246837 - 36247178
Alignment:
| Q |
19 |
acacatggatcaagaagcatgcaccatgttgttgaatccaccttttgataataattcaatgtctttcattcaaacacacttggagaatatatgctcatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36246837 |
acacatggatcaagaagcatgcaccatgttgttgaatccaccttttgataataattcaatgtctttcattcaaacacacttggagaatatatactcatca |
36246936 |
T |
 |
| Q |
119 |
tttttacctgaatttggcttccaacaacatcatgaaaat------------tattttcattgcaatggaattgcttcaagtaatgtaacagaggattttg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36246937 |
tttttacctgaatttggcttccaacaacatcatgaaaatgttcaattaaattatttgcattgcaatggaattgcttcaagtaatgtaacagaggattttg |
36247036 |
T |
 |
| Q |
207 |
ttcatcaattaccatgctataactacttaagttctgattatcatgcaaatgatttaaatgtggaccctcacatatcagaaacttcaacctttcattgcaa |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36247037 |
ttcatcaattaccatgctataactacttaagttctgattatcatgcaaatgatttaaatgtggaccctcacatatcagaaacttcaacctttcattgcaa |
36247136 |
T |
 |
| Q |
307 |
taacaacaaccagaattttaatttcgcttcagttctatctac |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36247137 |
taacaacaaccagaattttaatttcgcttcagttctatctac |
36247178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University