View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19009_low_37 (Length: 355)
Name: NF19009_low_37
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19009_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 1 - 337
Target Start/End: Original strand, 51552209 - 51552545
Alignment:
| Q |
1 |
tgacttgaacagttggttaagtgctgttatcaccttccaagaaacttgcgttgatggttttcctgatggaaaattgaagactgatcttcagaaattgttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51552209 |
tgacttgaacagttggttaagtgctgttatcactttccaagaaacttgcgttgatggttttcctgatggaaaattgaagactgatcttcagaaattgttt |
51552308 |
T |
|
| Q |
101 |
cagggttctagggaatttgttagcaattctcttgctattgtgtctcaggtttctacattcctttcttcattgcagacaatgggggccccccgtatgttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51552309 |
cagggttctagggaatttgttagcaattctcttgctattgtgtctcaggtttctacattcctttcttcattgcagacaatgggggccccccgtatgttgt |
51552408 |
T |
|
| Q |
201 |
tgtctgataactcccctgttgcttctatggattctgaaggtattccttcatggattcaatctgaagagagaagggtgttgaaggctgctgatattagacc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51552409 |
tgtctgataactcccctgttgcttctatggattctgaaggtattccttcatggattcaatctgaagagagaagggtgttgaaggctgctgatattagacc |
51552508 |
T |
|
| Q |
301 |
taaacctaatgtcgttgttgctaaagatggcagtggt |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51552509 |
taaacctaatgtcgttgttgctaaagatggcagtggt |
51552545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University