View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19009_low_55 (Length: 315)
Name: NF19009_low_55
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19009_low_55 |
 |  |
|
| [»] scaffold0143 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 12)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 24 - 303
Target Start/End: Original strand, 18253338 - 18253626
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtccgtacaactgagctaacttgtattaaaaagcaagattttttccccacttataatctacat |
123 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| | | ||| ||||||||||| ||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18253338 |
ggggtttgaaccctggaccttgcatatattatgcattgttcatgcaagtgagctaacttatatgaaaaagcacgattttttccccacttataatctacat |
18253437 |
T |
 |
| Q |
124 |
ttcaatataacacaaaagcaaa--------ccaggatactatatgtacgactcatggtcactgataagtgggaaaacgctcgagcatagcgagatgagtg |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18253438 |
ttcaatataacacaaaagcaaaaaatgaaaccaggatactatatgtacgactcatggtcactgataagtgggaaaacgctctagcatagcgagatgagtg |
18253537 |
T |
 |
| Q |
216 |
tttaataaaaaa-ctacattattgtcaacaacctctatcgtccaagacgtagacacaattggttgaattgtgatcaatcgtttgcattc |
303 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18253538 |
tttaataaaaaatctacattattgtcagcaacctctatcgtccaagacgtagacacaattggttgaattgtgatcgatcgtttgcattc |
18253626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 24623315 - 24623372
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||| || |||||||||||| |
|
|
| T |
24623315 |
cggggtttgaaccccgaaccttacatatattatgcattgtccatatcaactgagctaa |
24623372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 64
Target Start/End: Complemental strand, 8569774 - 8569731
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
8569774 |
gccggggtttgaaccccggaccttgcatatattatgcattgtcc |
8569731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 64
Target Start/End: Original strand, 26356077 - 26356120
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||| |||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
26356077 |
gccggagtttgaaccccgaaccttgcatatattatgcattgtcc |
26356120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 79
Target Start/End: Complemental strand, 32053853 - 32053794
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||| ||||||||| |||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
32053853 |
gccggagtttgaaccacgaaccttgcatatattatgcattgtccataccaactgagctaa |
32053794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 79
Target Start/End: Complemental strand, 33824946 - 33824887
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||| ||||||||||| | |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
33824946 |
gccgaggtttgaaccccggaccttgcatatattatgcattgtccttatcaactgagctaa |
33824887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 26 - 64
Target Start/End: Original strand, 8629697 - 8629735
Alignment:
| Q |
26 |
ggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
8629697 |
ggtttgaaccccgaaccttgcatatattatgcattgtcc |
8629735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 64
Target Start/End: Complemental strand, 788929 - 788888
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
788929 |
cggggtttgaactccgaaccttgcatatattatgcattgtcc |
788888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 866283 - 866340
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||| || | || |||||||||||| |
|
|
| T |
866283 |
cggggtttgaaccatgaaccttgcatatattatgcatcgtgcctaccaactgagctaa |
866340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Complemental strand, 20744201 - 20744144
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
20744201 |
cggggtttgaaccccagaccttgcatatattatgcattgtccataccaactgagctaa |
20744144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 80
Target Start/End: Original strand, 14441455 - 14441511
Alignment:
| Q |
25 |
gggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaac |
80 |
Q |
| |
|
||||||||| || |||||| ||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
14441455 |
gggtttgaagcccgaaccttgcatacattatgcattgtccttaccaactgagctaac |
14441511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 64
Target Start/End: Original strand, 32524419 - 32524459
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
32524419 |
ggggtttgaaccctggactttgcatatattatgcattgtcc |
32524459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 29)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 21 - 79
Target Start/End: Complemental strand, 23810014 - 23809955
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||| || |||||||||||| |
|
|
| T |
23810014 |
gccggggtttgaaccctgaaccttgcatatattatgctttgtccataccaactgagctaa |
23809955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 24 - 79
Target Start/End: Original strand, 28435247 - 28435303
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
28435247 |
ggggtttgaaccccgaaccttgcatatattatgcattgtccataccaactgagctaa |
28435303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 22040711 - 22040656
Alignment:
| Q |
25 |
gggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
22040711 |
gggtttgaaccccgaaccttgcatatattatgcattgtccatatcaactgagctaa |
22040656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 25 - 79
Target Start/End: Original strand, 39171370 - 39171425
Alignment:
| Q |
25 |
gggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||| || |||||||||||| |
|
|
| T |
39171370 |
gggtttgaaccctgaaccttgcatattttatgcattgtccatatcaactgagctaa |
39171425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 23 - 61
Target Start/End: Original strand, 30850382 - 30850420
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattg |
61 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30850382 |
cggggtttgaaccctgaaccttgcatatattatgcattg |
30850420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 26 - 79
Target Start/End: Original strand, 50362140 - 50362194
Alignment:
| Q |
26 |
ggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
50362140 |
ggtttgaaccctggaccttgcatatattatgcattgtccctaccaactgagctaa |
50362194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 11949761 - 11949818
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||| | |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
11949761 |
cggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaa |
11949818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 64
Target Start/End: Complemental strand, 25115112 - 25115071
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
25115112 |
cggggtttgaaccctgaaccttgcatatgttatgcattgtcc |
25115071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 79
Target Start/End: Complemental strand, 20383550 - 20383494
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
20383550 |
ggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaa |
20383494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 79
Target Start/End: Complemental strand, 7230345 - 7230286
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||| ||||||||||| | |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
7230345 |
gccgaggtttgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaa |
7230286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 64
Target Start/End: Complemental strand, 10148244 - 10148201
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
10148244 |
gccgaggtttgaactctgaaccttgcatatattatgcattgtcc |
10148201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 64
Target Start/End: Complemental strand, 19588219 - 19588176
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
19588219 |
gccggggtttgaaccctggaccttgcatattttatgcattgtcc |
19588176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 25 - 79
Target Start/End: Original strand, 20799394 - 20799449
Alignment:
| Q |
25 |
gggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||| | |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
20799394 |
gggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaa |
20799449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 40 - 79
Target Start/End: Complemental strand, 25978363 - 25978324
Alignment:
| Q |
40 |
acctcgcatatattatgcattgtccgtacaactgagctaa |
79 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
25978363 |
accttgcatatattatgcattgtccttacaactgagctaa |
25978324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 79
Target Start/End: Complemental strand, 37921811 - 37921752
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgtac-aactgagctaa |
79 |
Q |
| |
|
||||||||||||| || | |||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
37921811 |
gccggggtttgaatcccggaccttgcatatattatgcattgtccttactaactgagctaa |
37921752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 56551588 - 56551647
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||||||| | |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
56551588 |
gccggggtttgaacctcggaccttgcatatattatgcattgtccttaccaactgagctaa |
56551647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 26 - 79
Target Start/End: Complemental strand, 12322733 - 12322679
Alignment:
| Q |
26 |
ggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||| | | || ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12322733 |
ggtttgaaccccggaacttgcatatattatgcattgtccgtaccaactgagctaa |
12322679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 21 - 63
Target Start/End: Original strand, 49041977 - 49042019
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtc |
63 |
Q |
| |
|
|||||||||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
49041977 |
gccggggtttgaaccccggaccttgcatatattatgcattgtc |
49042019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 21 - 59
Target Start/End: Original strand, 50152234 - 50152272
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcat |
59 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
50152234 |
gccggggtttgaaccccgaaccttgcatatattatgcat |
50152272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 64
Target Start/End: Original strand, 55421574 - 55421608
Alignment:
| Q |
30 |
tgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
55421574 |
tgaaccctgaaccttgcatatattatgcattgtcc |
55421608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Complemental strand, 9946490 - 9946433
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||| | |||| |||||| ||||||||||||| || |||||||||||| |
|
|
| T |
9946490 |
cggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
9946433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 64
Target Start/End: Original strand, 21318251 - 21318292
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
21318251 |
cggggtttgaaccctagaccttgcatatattatgcattgtcc |
21318292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 64
Target Start/End: Original strand, 39093573 - 39093614
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
39093573 |
cggggtttgaaccctaaactttgcatatattatgcattgtcc |
39093614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 43374270 - 43374327
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||| | |||||| |||||| ||||||||||||| || |||||||||||| |
|
|
| T |
43374270 |
cggggtttgaactccgaaccttgcatattttatgcattgtccatatcaactgagctaa |
43374327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 64
Target Start/End: Complemental strand, 675980 - 675940
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
675980 |
ggggtttgaaccccggaccttgcatatattatgcattgtcc |
675940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 78
Target Start/End: Complemental strand, 22411823 - 22411771
Alignment:
| Q |
27 |
gtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagcta |
78 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
22411823 |
gtttgaaccccgaaccttacatatattatgcattgtccataccaactgagcta |
22411771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 64
Target Start/End: Complemental strand, 23775580 - 23775540
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||| |||||||| |||| |||||||||||||||||||| |
|
|
| T |
23775580 |
ggggttcgaaccctggaccttgcatatattatgcattgtcc |
23775540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 64
Target Start/End: Complemental strand, 38453327 - 38453287
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||| |||||||| |||| |||||||||||||||||||| |
|
|
| T |
38453327 |
ggggttcgaaccctggaccttgcatatattatgcattgtcc |
38453287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 63
Target Start/End: Complemental strand, 41521013 - 41520977
Alignment:
| Q |
27 |
gtttgaaccctgaacctcgcatatattatgcattgtc |
63 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
41521013 |
gtttgaaccttgaaccttgcatatattatgcattgtc |
41520977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 24)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 23 - 64
Target Start/End: Complemental strand, 11560561 - 11560520
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11560561 |
cggggtttgaaccctgaaccttgcatatattatgcattgtcc |
11560520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 79
Target Start/End: Original strand, 20120718 - 20120776
Alignment:
| Q |
22 |
ccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||| ||||||||| |||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
20120718 |
ccgggatttgaaccccgaaccttgcatatattatgcattgtccttaccaactgagctaa |
20120776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 64
Target Start/End: Original strand, 660820 - 660861
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
660820 |
cggggtttgaaccctggaccttgcatatattatgcattgtcc |
660861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 62
Target Start/End: Complemental strand, 20200770 - 20200729
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgt |
62 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
20200770 |
gccggggtttgaaccctggaccttgcatatattatgcattgt |
20200729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 25 - 62
Target Start/End: Complemental strand, 38904122 - 38904085
Alignment:
| Q |
25 |
gggtttgaaccctgaacctcgcatatattatgcattgt |
62 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38904122 |
gggtttgaaccctgaaccttgcatatattatgcattgt |
38904085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 79
Target Start/End: Original strand, 20565074 - 20565130
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
20565074 |
ggggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaa |
20565130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 63
Target Start/End: Original strand, 20990902 - 20990942
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtc |
63 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
20990902 |
cggggtttgaaccctgaaccttgcatattttatgcattgtc |
20990942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 79
Target Start/End: Original strand, 25186241 - 25186297
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
25186241 |
ggggtttgaaccccggaccttgcatatattatgcattgtccatatcaactgagctaa |
25186297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 10735827 - 10735886
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||||| | |||| ||||||||||||||| |||| || |||||||||||| |
|
|
| T |
10735827 |
gccggggtttgaaccccggaccttgcatatattatgcatcgtccctaccaactgagctaa |
10735886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 23 - 62
Target Start/End: Original strand, 23250318 - 23250357
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgt |
62 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
23250318 |
cggggtttgaaccctggaccttgcatatattatgcattgt |
23250357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 24592842 - 24592901
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
24592842 |
gccggggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaa |
24592901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 25 - 79
Target Start/End: Original strand, 25598562 - 25598617
Alignment:
| Q |
25 |
gggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||| |||||||| |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
25598562 |
gggttcgaaccctggaccttgcatatattatgcattgtccataccaactgagctaa |
25598617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 64
Target Start/End: Complemental strand, 29544692 - 29544649
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
29544692 |
gccggggtttgaaccccggaccttgcatatattatgcattgtcc |
29544649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 64
Target Start/End: Complemental strand, 42791360 - 42791317
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
42791360 |
gccggggtttgaaccccggaccttgcatatattatgcattgtcc |
42791317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 21 - 63
Target Start/End: Complemental strand, 44694753 - 44694711
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtc |
63 |
Q |
| |
|
|||||||||||||||| || ||| ||||||||||||||||||| |
|
|
| T |
44694753 |
gccggggtttgaaccccgagccttgcatatattatgcattgtc |
44694711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 3197078 - 3197134
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||| || |||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
3197078 |
cggggtttgaatcc-gaaccttgcatatattatgcattgtccctaccaactgagctaa |
3197134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 60
Target Start/End: Original strand, 5168577 - 5168614
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcatt |
60 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
5168577 |
cggggtttgaaccccgaaccttgcatatattatgcatt |
5168614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 8781648 - 8781705
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||| | |||| ||||| |||||||||||||| || |||||||||||| |
|
|
| T |
8781648 |
cggggtttgaaccccggaccttgcatacattatgcattgtccataccaactgagctaa |
8781705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 64
Target Start/End: Original strand, 9547407 - 9547448
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
9547407 |
cggggtttgaaccccaaaccttgcatatattatgcattgtcc |
9547448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 64
Target Start/End: Original strand, 18693660 - 18693701
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||| | || |||||||||||||||||||| |
|
|
| T |
18693660 |
cggggtttgaaccctggatcttgcatatattatgcattgtcc |
18693701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 64
Target Start/End: Original strand, 24579670 - 24579707
Alignment:
| Q |
27 |
gtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
24579670 |
gtttgaaccctggaccttgcatatattatgcattgtcc |
24579707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Complemental strand, 27244720 - 27244663
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||| |||||||||| |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
27244720 |
cgggctttgaaccctagaccttgcatatattatgcattgtccctatcaactgagctaa |
27244663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Complemental strand, 29734754 - 29734697
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
29734754 |
cggggtttgaaccacggaccttgcatatattatgcattgtccatatcaactgagctaa |
29734697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 64
Target Start/End: Original strand, 31815885 - 31815926
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
31815885 |
cggggtttgaaccccggaccttgcatatattatgcattgtcc |
31815926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000007; HSPs: 18)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 24 - 79
Target Start/End: Complemental strand, 3830130 - 3830074
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtccgtac-aactgagctaa |
79 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
3830130 |
ggggtttgaaccctggaccttgcatatattatgcattgtccctacaaactgagctaa |
3830074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 78
Target Start/End: Original strand, 27462432 - 27462490
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagcta |
78 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||||||||||| || ||||||||||| |
|
|
| T |
27462432 |
gccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagcta |
27462490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 79
Target Start/End: Complemental strand, 18714511 - 18714454
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||| | |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
18714511 |
cggggtttgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaa |
18714454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 10244788 - 10244733
Alignment:
| Q |
25 |
gggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||| | |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
10244788 |
gggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaa |
10244733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 79
Target Start/End: Complemental strand, 19416579 - 19416520
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||||| | |||| |||||| ||||||||||||| || |||||||||||| |
|
|
| T |
19416579 |
gccggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
19416520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 64
Target Start/End: Original strand, 38374187 - 38374230
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
| T |
38374187 |
gccggggtttgaaccctggaccttgcatatactatgcattgtcc |
38374230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 64
Target Start/End: Complemental strand, 6781871 - 6781829
Alignment:
| Q |
22 |
ccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||||||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
6781871 |
ccggggtttgaaccctggaccttgcatattttatgcattgtcc |
6781829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 27 - 69
Target Start/End: Complemental strand, 18023738 - 18023696
Alignment:
| Q |
27 |
gtttgaaccctgaacctcgcatatattatgcattgtccgtaca |
69 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||| |||| |
|
|
| T |
18023738 |
gtttgaaccctggaccttgcatatattatgcattgtccctaca |
18023696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 26 - 79
Target Start/End: Original strand, 39926539 - 39926593
Alignment:
| Q |
26 |
ggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||| |||| | |||||||||||||||||||| || |||||||||||| |
|
|
| T |
39926539 |
ggtttgaaccccgaacattgcatatattatgcattgtccttatcaactgagctaa |
39926593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 79
Target Start/End: Complemental strand, 46987150 - 46987092
Alignment:
| Q |
22 |
ccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||| |||||| | |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
46987150 |
ccggggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgagctaa |
46987092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 64
Target Start/End: Original strand, 47155101 - 47155143
Alignment:
| Q |
22 |
ccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||| |||||||| |||| |||||||||||||||||||| |
|
|
| T |
47155101 |
ccggggttcgaaccctggaccttgcatatattatgcattgtcc |
47155143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 79
Target Start/End: Complemental strand, 4047845 - 4047792
Alignment:
| Q |
26 |
ggtttgaaccctgaacctcgcatatattatgcattgtccgtacaactgagctaa |
79 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||| ||| |||||||||||| |
|
|
| T |
4047845 |
ggtttaaaccctgaaccttgcatatattatgcattatcctatcaactgagctaa |
4047792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 60
Target Start/End: Complemental strand, 10242543 - 10242506
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcatt |
60 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
10242543 |
cggggtttgaaccctggaccttgcatatattatgcatt |
10242506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 64
Target Start/End: Complemental strand, 19599208 - 19599167
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
19599208 |
cggggtttgaaccccggaccttgcatatattatgcattgtcc |
19599167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 63
Target Start/End: Complemental strand, 20455200 - 20455159
Alignment:
| Q |
22 |
ccggggtttgaaccctgaacctcgcatatattatgcattgtc |
63 |
Q |
| |
|
|||||||||||| ||||||||| | ||||||||||||||||| |
|
|
| T |
20455200 |
ccggggtttgaatcctgaaccttgaatatattatgcattgtc |
20455159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 78
Target Start/End: Original strand, 27833399 - 27833455
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagcta |
78 |
Q |
| |
|
|||||||||||||| | |||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
27833399 |
cggggtttgaaccccggaccttacatatattatgcattgtccttaccaactgagcta |
27833455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 40 - 79
Target Start/End: Original strand, 33610940 - 33610980
Alignment:
| Q |
40 |
acctcgcatatattatgcattgtccgt-acaactgagctaa |
79 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33610940 |
accttgcatatattatgcattgtccgtaacaactgagctaa |
33610980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 63
Target Start/End: Original strand, 46909814 - 46909846
Alignment:
| Q |
31 |
gaaccctgaacctcgcatatattatgcattgtc |
63 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
46909814 |
gaaccctgaacctcgtatatattatgcattgtc |
46909846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 17)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 8717471 - 8717530
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||| ||||||||||| |||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
8717471 |
gccgaggtttgaaccccgaaccttgcatatattatgcattgtccataccaactgagctaa |
8717530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 64
Target Start/End: Complemental strand, 8881340 - 8881297
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
8881340 |
gccggggtttgaaccctggaccttgcatatattatgcattgtcc |
8881297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 64
Target Start/End: Complemental strand, 12748966 - 12748923
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
12748966 |
gccggggtttgaaccccggaccttgcatatattatgcattgtcc |
12748923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 79
Target Start/End: Complemental strand, 27587286 - 27587227
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||||| | |||| |||||||| ||||||||||| || |||||||||||| |
|
|
| T |
27587286 |
gccggggtttgaaccccggaccttgcatatatcatgcattgtccttaccaactgagctaa |
27587227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 64
Target Start/End: Original strand, 32051528 - 32051571
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
32051528 |
gccggggtttgaaccccggaccttgcatatattatgcattgtcc |
32051571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 64
Target Start/End: Complemental strand, 37141422 - 37141379
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||| |||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
37141422 |
gccggagtttgaaccccgaaccttgcatatattatgcattgtcc |
37141379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 64
Target Start/End: Original strand, 35198534 - 35198576
Alignment:
| Q |
22 |
ccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||| |||| |||||||| |||||||||||||||||||| |
|
|
| T |
35198534 |
ccggggttcgaactctgaaccttgcatatattatgcattgtcc |
35198576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 62
Target Start/End: Complemental strand, 6471576 - 6471535
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgt |
62 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||| |
|
|
| T |
6471576 |
gccggggtttgaaccccgaacattgcatatattatgcattgt |
6471535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 64
Target Start/End: Original strand, 7869639 - 7869680
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
7869639 |
cggggtttgaacccccaaccttgcatatattatgcattgtcc |
7869680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 19163534 - 19163591
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||| | |||| ||||| |||||||||||||| || |||||||||||| |
|
|
| T |
19163534 |
cggggtttgaaccccggaccttgcataaattatgcattgtccataccaactgagctaa |
19163591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 64
Target Start/End: Complemental strand, 23159504 - 23159463
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||| ||| || |||||||||||||||||||| |
|
|
| T |
23159504 |
cggggtttgaaccccgaatcttgcatatattatgcattgtcc |
23159463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 64
Target Start/End: Complemental strand, 32192957 - 32192916
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||| |||||| |||||| |||||||||||||||||||| |
|
|
| T |
32192957 |
cggggttcgaaccccgaaccttgcatatattatgcattgtcc |
32192916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 33482143 - 33482188
Alignment:
| Q |
19 |
ttgccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
33482143 |
ttgccgggatttgaaccctggaccttgcataaattatgcattgtcc |
33482188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 63
Target Start/End: Original strand, 3672614 - 3672654
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtc |
63 |
Q |
| |
|
||||||||||||||| ||||| |||||| |||||||||||| |
|
|
| T |
3672614 |
cggggtttgaaccctaaaccttgcatattttatgcattgtc |
3672654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 64
Target Start/End: Original strand, 12714373 - 12714409
Alignment:
| Q |
28 |
tttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
12714373 |
tttgaaccccgaaccttgcatatattatgcattgtcc |
12714409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 64
Target Start/End: Original strand, 20275188 - 20275228
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||||||||| |||||| |||| ||||||||||||||| |
|
|
| T |
20275188 |
ggggtttgaaccccgaaccttgcatgtattatgcattgtcc |
20275228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 64
Target Start/End: Original strand, 21061815 - 21061855
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||||||||| |||||| |||| ||||||||||||||| |
|
|
| T |
21061815 |
ggggtttgaaccccgaaccttgcatgtattatgcattgtcc |
21061855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 31)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 79
Target Start/End: Complemental strand, 29631251 - 29631192
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||||| || |||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
29631251 |
gccggggtttgaatcccgaaccttgcatatattatgcattgtccataccaactgagctaa |
29631192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 79
Target Start/End: Complemental strand, 52119441 - 52119382
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||| |||||| |||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
52119441 |
gccggggttcgaaccccgaaccttgcatatattatgcattgtccttaccaactgagctaa |
52119382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 22 - 63
Target Start/End: Original strand, 16792971 - 16793012
Alignment:
| Q |
22 |
ccggggtttgaaccctgaacctcgcatatattatgcattgtc |
63 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
16792971 |
ccggggtttgaaccctggaccttgcatatattatgcattgtc |
16793012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 16980352 - 16980409
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||| |||||||| ||||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
16980352 |
cgggatttgaaccatgaaccttgcatatattatgcattgtccttaccaactgagctaa |
16980409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 22 - 75
Target Start/End: Original strand, 28965774 - 28965827
Alignment:
| Q |
22 |
ccggggtttgaaccctgaacctcgcatatattatgcattgtccgtacaactgag |
75 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
28965774 |
ccggggtttgaaccccgaaccttacatatattatgcattgttcatacaactgag |
28965827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 64
Target Start/End: Original strand, 30554873 - 30554914
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
30554873 |
cggggtttgaaccctgaaccttgcatatagtatgcattgtcc |
30554914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 79
Target Start/End: Complemental strand, 34899160 - 34899103
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgtac-aactgagctaa |
79 |
Q |
| |
|
|||||||||||||| | |||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
34899160 |
cggggtttgaaccccggaccttgcatatattatgcattgtccctacgaactgagctaa |
34899103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 22 - 62
Target Start/End: Original strand, 7202913 - 7202953
Alignment:
| Q |
22 |
ccggggtttgaaccctgaacctcgcatatattatgcattgt |
62 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
7202913 |
ccggggtttgaaccctgaaccttgcatattttatgcattgt |
7202953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 28 - 79
Target Start/End: Complemental strand, 10926527 - 10926475
Alignment:
| Q |
28 |
tttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
10926527 |
tttgaaccccgaaccttgcatatattatgcattgtccttaccaactgagctaa |
10926475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 64
Target Start/End: Complemental strand, 39779086 - 39779046
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
39779086 |
ggggtttgaaccccgaaccttgcatatattatgcattgtcc |
39779046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 64
Target Start/End: Original strand, 759590 - 759633
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||| |||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
759590 |
gccgaggtttgaaccctgaactttgcatatattatgcattgtcc |
759633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 25340920 - 25340979
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||||| | |||| |||||| ||||||||||||| || |||||||||||| |
|
|
| T |
25340920 |
gccggggtttgaaccccggaccttgcatattttatgcattgtccataccaactgagctaa |
25340979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 25441496 - 25441555
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
25441496 |
gccggggtttgaaccccagaccttgcatatattatgcattgtccataccaactgagctaa |
25441555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 64
Target Start/End: Original strand, 38130955 - 38130998
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
38130955 |
gccggggtttgaaccccggaccttgcatatattatgcattgtcc |
38130998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 60
Target Start/End: Complemental strand, 38603023 - 38602984
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcatt |
60 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
38603023 |
gccggggtttgaaccatgaaccttgcatatattatgcatt |
38602984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 45432009 - 45431954
Alignment:
| Q |
25 |
gggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||| | |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
45432009 |
gggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaa |
45431954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 64
Target Start/End: Original strand, 48796214 - 48796257
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||| |||||| |||||| ||||||||||||| |
|
|
| T |
48796214 |
gccggggtttgaaccccgaaccttgcatatcttatgcattgtcc |
48796257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 64
Target Start/End: Original strand, 51882196 - 51882239
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||||| | || |||||||||||||||||||| |
|
|
| T |
51882196 |
gccggggtttgaaccctggatcttgcatatattatgcattgtcc |
51882239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 26 - 64
Target Start/End: Complemental strand, 10594737 - 10594699
Alignment:
| Q |
26 |
ggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
10594737 |
ggtttgaaccctaaaccttgcatatattatgcattgtcc |
10594699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 46903976 - 46903930
Alignment:
| Q |
18 |
gttgccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
46903976 |
gttgccggagtttgaaccctggaccttacatatattatgcattgtcc |
46903930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 21 - 63
Target Start/End: Original strand, 48849759 - 48849801
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtc |
63 |
Q |
| |
|
|||||||||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
48849759 |
gccggggtttgaaccccggaccttgcatatattatgcattgtc |
48849801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 79
Target Start/End: Original strand, 54230096 - 54230154
Alignment:
| Q |
22 |
ccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||| |||||| ||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
54230096 |
ccggggttcgaaccccaaaccttgcatatattatgcattgtccttaccaactgagctaa |
54230154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 62
Target Start/End: Original strand, 20612273 - 20612314
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgt |
62 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
20612273 |
gccggggtttgaaccccaaaccttgcatatattatgcattgt |
20612314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 79
Target Start/End: Original strand, 21331423 - 21331472
Alignment:
| Q |
31 |
gaaccctgaacctcgcatatattatgcattgtccgt-acaactgagctaa |
79 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||| | ||||||||||||| |
|
|
| T |
21331423 |
gaaccccgaaccttgcatatattatgcattgtccataacaactgagctaa |
21331472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Complemental strand, 21549101 - 21549044
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||| ||||||| ||||| ||||||||||| |||||||| || |||||||||||| |
|
|
| T |
21549101 |
cggggttcgaaccctaaaccttgcatatattatacattgtccatatcaactgagctaa |
21549044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 23147976 - 23148033
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||| |||||| | ||||||||||||||||| ||||||| || |||||||||||| |
|
|
| T |
23147976 |
cggggttcgaaccccggacctcgcatatattatgtattgtccttaccaactgagctaa |
23148033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 48209209 - 48209266
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||| || |||||||||||| |
|
|
| T |
48209209 |
cggggtttgaaccctgaaccttatatatattatgtattgtccctatcaactgagctaa |
48209266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 79
Target Start/End: Complemental strand, 50037370 - 50037317
Alignment:
| Q |
27 |
gtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||||||| || |||||||||||| |
|
|
| T |
50037370 |
gtttgaaccccgaaccttgcatacattatgcattgtccataccaactgagctaa |
50037317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 25727965 - 25728021
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgtacaactgagctaa |
79 |
Q |
| |
|
|||| ||||||||| | |||| |||||||||||||||||||| |||| || |||||| |
|
|
| T |
25727965 |
cgggatttgaaccccggaccttgcatatattatgcattgtccatacagctaagctaa |
25728021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 64
Target Start/End: Original strand, 27065731 - 27065771
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
27065731 |
ggggtttgaaccctggaccttgcatattttatgcattgtcc |
27065771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 64
Target Start/End: Original strand, 54018409 - 54018445
Alignment:
| Q |
28 |
tttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
54018409 |
tttgaaccctgaaccttgcatattttatgcattgtcc |
54018445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 18)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 64
Target Start/End: Complemental strand, 5907863 - 5907821
Alignment:
| Q |
22 |
ccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
5907863 |
ccggggtttgaaccctggaccttgcatatattatgcattgtcc |
5907821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 64
Target Start/End: Complemental strand, 27533306 - 27533265
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
27533306 |
cggggtttgaaccccgaaccttgcatatattatgcattgtcc |
27533265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 17284012 - 17283957
Alignment:
| Q |
25 |
gggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||| |||||||| |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
17284012 |
gggttcgaaccctggaccttgcatatattatgcattgtccttaccaactgagctaa |
17283957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 64
Target Start/End: Complemental strand, 25533038 - 25532995
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
25533038 |
gccggggtttgaaccccggaccttgcatatattatgcattgtcc |
25532995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 25 - 64
Target Start/End: Original strand, 27449445 - 27449484
Alignment:
| Q |
25 |
gggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
27449445 |
gggtttgaaccctgaatcttgcatatattatgcattgtcc |
27449484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 34521186 - 34521245
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||| ||||||||||| | |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
34521186 |
gccgaggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaa |
34521245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 45140002 - 45140061
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||| ||| ||| |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
45140002 |
gccggggtttaaactctggaccttgcatatattatgcattgtccataccaactgagctaa |
45140061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 50638912 - 50638971
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||| || |||||||| |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
50638912 |
gccgggattcgaaccctggaccttgcatatattatgcattgtccttaccaactgagctaa |
50638971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 60
Target Start/End: Complemental strand, 35474016 - 35473978
Alignment:
| Q |
22 |
ccggggtttgaaccctgaacctcgcatatattatgcatt |
60 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
35474016 |
ccggggttcgaaccctgaaccttgcatatattatgcatt |
35473978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 8269366 - 8269423
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||| | |||| |||||||||||| ||||||| || |||||||||||| |
|
|
| T |
8269366 |
cggggtttgaaccccggaccttgcatatattatgtattgtccttaccaactgagctaa |
8269423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 17139515 - 17139572
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||| | |||| | |||||||||||||||||| || |||||||||||| |
|
|
| T |
17139515 |
cggggtttgaaccccggaccttgaatatattatgcattgtccctaccaactgagctaa |
17139572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 64
Target Start/End: Complemental strand, 35011456 - 35011415
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||| |||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
35011456 |
cgggttttgaaccttgaaccttgcatatattatgcattgtcc |
35011415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 36 - 79
Target Start/End: Complemental strand, 8253789 - 8253745
Alignment:
| Q |
36 |
ctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
8253789 |
ctgaaccttgcatatattatgcattgtccataccaactgagctaa |
8253745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 64
Target Start/End: Original strand, 9929230 - 9929270
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||| ||||||| |||| |||||||||||||||||||| |
|
|
| T |
9929230 |
ggggttttaaccctggaccttgcatatattatgcattgtcc |
9929270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 63
Target Start/End: Complemental strand, 13401660 - 13401620
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtc |
63 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
13401660 |
cggggtttgaaccccgaaccttacatatattatgcattgtc |
13401620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 79
Target Start/End: Original strand, 26803450 - 26803506
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||||| | || | |||||||||||||||||||| || |||||||||||| |
|
|
| T |
26803450 |
ggggtttgaaccccggactttgcatatattatgcattgtccataccaactgagctaa |
26803506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 40 - 79
Target Start/End: Original strand, 31890764 - 31890804
Alignment:
| Q |
40 |
acctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
31890764 |
acctcgcatatattatgcattgtccttaccaactgagctaa |
31890804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 79
Target Start/End: Original strand, 44678020 - 44678072
Alignment:
| Q |
28 |
tttgaaccctgaacctcgcatatattatgcattgtccgtac-aactgagctaa |
79 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
44678020 |
tttgaaccccgaaccttgcatatattatgcattgtctatacaaactgagctaa |
44678072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 16)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 79
Target Start/End: Complemental strand, 15889474 - 15889417
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
15889474 |
cggggtttgaaccctagaccttgcatatattatgcattgtccctaccaactgagctaa |
15889417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 64
Target Start/End: Complemental strand, 16076494 - 16076453
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16076494 |
cggggattgaaccctgaaccttgcatatattatgcattgtcc |
16076453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 28 - 79
Target Start/End: Complemental strand, 17862037 - 17861985
Alignment:
| Q |
28 |
tttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| || |||||||||||| |
|
|
| T |
17862037 |
tttgaaccctgaactttgcatatattatgcattgtccctaccaactgagctaa |
17861985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 79
Target Start/End: Complemental strand, 6489072 - 6489013
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
6489072 |
gccggggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaa |
6489013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 64
Target Start/End: Original strand, 22522797 - 22522840
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
22522797 |
gccggggtttgaaccccggaccttgcatatattatgcattgtcc |
22522840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 21 - 64
Target Start/End: Original strand, 40715945 - 40715988
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
40715945 |
gccggggtttgaaccccggaccttgcatatattatgcattgtcc |
40715988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 26166800 - 26166746
Alignment:
| Q |
25 |
gggtttgaaccctgaacctcgcatatattatgcattgtccgtacaactgagctaa |
79 |
Q |
| |
|
|||||||||||||| |||| |||||| | |||||||||||| |||||||||||| |
|
|
| T |
26166800 |
gggtttgaaccctggaccttgcatatttgatgcattgtccgaccaactgagctaa |
26166746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 64
Target Start/End: Original strand, 41630109 - 41630151
Alignment:
| Q |
22 |
ccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
41630109 |
ccggggtttgaatcccgaaccttgcatatattatgcattgtcc |
41630151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 79
Target Start/End: Original strand, 11844444 - 11844493
Alignment:
| Q |
31 |
gaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
11844444 |
gaaccctaaaccttgcatatattatgcattgtccttaccaactgagctaa |
11844493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 13409483 - 13409434
Alignment:
| Q |
31 |
gaaccctgaacctcgcatatattatgcattgtccgtac-aactgagctaa |
79 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
13409483 |
gaaccctgaaccttgcatatattatgcattgtctttactaactgagctaa |
13409434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 62
Target Start/End: Complemental strand, 14474899 - 14474858
Alignment:
| Q |
21 |
gccggggtttgaaccctgaacctcgcatatattatgcattgt |
62 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||| |||| |
|
|
| T |
14474899 |
gccggggtttgaaccctggaccttgcatatattatgcgttgt |
14474858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 79
Target Start/End: Complemental strand, 34436914 - 34436857
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
|||||||||||||| | ||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
34436914 |
cggggtttgaaccccggcccttgcatatattatgcattgtccctaccaactgagctaa |
34436857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 60
Target Start/End: Original strand, 37021370 - 37021407
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcatt |
60 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| |
|
|
| T |
37021370 |
cggggtttgaaccctgaatcttgcatatattatgcatt |
37021407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 64
Target Start/End: Complemental strand, 43108624 - 43108591
Alignment:
| Q |
31 |
gaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
43108624 |
gaaccctgaaccttgcatatattatgcattgtcc |
43108591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 79
Target Start/End: Complemental strand, 18789098 - 18789042
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtccgta-caactgagctaa |
79 |
Q |
| |
|
||||||||||||| |||||| |||||| |||||||||||| || |||||||||||| |
|
|
| T |
18789098 |
ggggtttgaaccccgaaccttgcatattttatgcattgtctctaccaactgagctaa |
18789042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 63
Target Start/End: Complemental strand, 40959065 - 40959025
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtc |
63 |
Q |
| |
|
|||||| ||||||||||| || ||||||||||||||||||| |
|
|
| T |
40959065 |
cggggtctgaaccctgaatcttgcatatattatgcattgtc |
40959025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0143 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0143
Description:
Target: scaffold0143; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 64
Target Start/End: Complemental strand, 4533 - 4488
Alignment:
| Q |
19 |
ttgccggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
4533 |
ttgccgggatttgaaccctggaccttgcataaattatgcattgtcc |
4488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 64
Target Start/End: Original strand, 72777 - 72814
Alignment:
| Q |
27 |
gtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
72777 |
gtttgaaccctggaccttgcatatattatgcattgtcc |
72814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 64
Target Start/End: Complemental strand, 161204 - 161163
Alignment:
| Q |
23 |
cggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||||||||||| |||||| |||||| ||||||||||||| |
|
|
| T |
161204 |
cggggtttgaaccccgaaccttgcatattttatgcattgtcc |
161163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 64
Target Start/End: Complemental strand, 25451 - 25411
Alignment:
| Q |
24 |
ggggtttgaaccctgaacctcgcatatattatgcattgtcc |
64 |
Q |
| |
|
|||||| |||||||| |||| |||||||||||||||||||| |
|
|
| T |
25451 |
ggggttcgaaccctggaccttgcatatattatgcattgtcc |
25411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University