View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19009_low_66 (Length: 271)
Name: NF19009_low_66
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19009_low_66 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 3805036 - 3805141
Alignment:
| Q |
1 |
taatgataccacaataccatcaaatgtagaaacacaataccagaacagctcgcttgaagatgaaacaaacagcaccgattctcgctcaaatgaaaatggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3805036 |
taatgataccacaataccatcaaatgtagaaacacagtaccagaatttttctcttgaagatgaaacaaacagcaccgattcttgctcaaatgaaaatggt |
3805135 |
T |
|
| Q |
101 |
gtgtaa |
106 |
Q |
| |
|
|||||| |
|
|
| T |
3805136 |
gtgtaa |
3805141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 187 - 256
Target Start/End: Original strand, 3809152 - 3809220
Alignment:
| Q |
187 |
atttgcttgaatgacacattatgcataaagttgaagatgatcagtatgtgccattccctgaagcaaatga |
256 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3809152 |
atttgcttgaatgacacat-atgcataaagttgaagatgatcagtatgtgccattccctaaagcaaatga |
3809220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 5164902 - 5164866
Alignment:
| Q |
1 |
taatgataccacaataccatcaaatgtagaaacacaa |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5164902 |
taatgataccacaataccatcaaatgtagaaacacaa |
5164866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 31742383 - 31742347
Alignment:
| Q |
1 |
taatgataccacaataccatcaaatgtagaaacacaa |
37 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31742383 |
taatgatacaacaataccatcaaatgtagaaacacaa |
31742347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University