View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19009_low_74 (Length: 252)
Name: NF19009_low_74
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19009_low_74 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 91 - 239
Target Start/End: Original strand, 29003356 - 29003505
Alignment:
| Q |
91 |
aattatttcatgttgcatttaaagttcatgccaccggtaaaatagtaccgcttgatactttcttttcatgatagatgcaattgacatttctgacggttgg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||| |
|
|
| T |
29003356 |
aattatttcatgttgcatttaaagttcatgccactggtaaaatagtaccacttgatactttcttttc-tgatagatgcaattgacgtttctagtggtt-a |
29003453 |
T |
|
| Q |
191 |
tataaaatctcacgtt---ttatctttacctacattatgttgtccagtataa |
239 |
Q |
| |
|
|||||||||||||| | ||||||| ||||||||||||||||||| ||||| |
|
|
| T |
29003454 |
tataaaatctcacgattcattatcttaacctacattatgttgtccaatataa |
29003505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 10 - 56
Target Start/End: Original strand, 29003312 - 29003358
Alignment:
| Q |
10 |
tataatagagatcaataagtgatctttaactcgttagaagtacgaat |
56 |
Q |
| |
|
||||||||||| |||| | |||||||||||||||||||||||||||| |
|
|
| T |
29003312 |
tataatagagaccaatgaatgatctttaactcgttagaagtacgaat |
29003358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 75
Target Start/End: Complemental strand, 19760312 - 19760247
Alignment:
| Q |
10 |
tataatagagatcaataagtgatctttaactcgttagaagtacgaatctattaacaaacacatgag |
75 |
Q |
| |
|
||||||| ||| |||||| ||||||||||||||||||| |||| |||||| || ||||||||||| |
|
|
| T |
19760312 |
tataataaagaccaataaatgatctttaactcgttagatgtacatatctatcaataaacacatgag |
19760247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University