View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19009_low_82 (Length: 246)
Name: NF19009_low_82
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19009_low_82 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 16 - 227
Target Start/End: Complemental strand, 6186757 - 6186546
Alignment:
| Q |
16 |
acatcatcgatcggaaaagttggtttggttgtcgcgtttttagtcttggttgttttattgattcgatatttcaccggtaacacaaagactgataacggag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||| |||||||||||||||| || |||||||||||| ||||| |
|
|
| T |
6186757 |
acatcatcgatcggaaaagttggtttggttgtcgcgtttttagtcctggttgttctcttggttcgatatttcaccgggaatacaaagactgatgccggag |
6186658 |
T |
|
| Q |
116 |
ttagagaattcaacggtagaaagactagtttcgacgatgtgatgaatgcgattattggaattattgctgatgctgttactattgttgttgttgcaattcc |
215 |
Q |
| |
|
||||||||||||| ||||||||||| ||||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6186657 |
ttagagaattcaatggtagaaagacgagttttgatgatgtgatgaatgcaattattggaattattgctgatgctgttactattgttgttgttgcaattcc |
6186558 |
T |
|
| Q |
216 |
tgagggtttgcc |
227 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6186557 |
tgagggtttgcc |
6186546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 16 - 224
Target Start/End: Complemental strand, 4243701 - 4243493
Alignment:
| Q |
16 |
acatcatcgatcggaaaagttggtttggttgtcgcgtttttagtcttggttgttttattgattcgatatttcaccggtaacacaaagactgataacggag |
115 |
Q |
| |
|
||||| || |||||||| |||||||||| |||||| ||||||||| | |||||| | |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4243701 |
acatcctcaatcggaaaggttggtttggctgtcgcatttttagtccttgttgttctgttgattcgatatttcaccgggaacacaaagactgataacggag |
4243602 |
T |
|
| Q |
116 |
ttagagaattcaacggtagaaagactagtttcgacgatgtgatgaatgcgattattggaattattgctgatgctgttactattgttgttgttgcaattcc |
215 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| || || |
|
|
| T |
4243601 |
ttagagagttcaacggtagaaagactagtttcgatgatgtgatgaatgcagttattggaattattgctgatgctgttactattgtcgttgttgctatccc |
4243502 |
T |
|
| Q |
216 |
tgagggttt |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
4243501 |
cgagggttt |
4243493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University