View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19009_low_86 (Length: 237)
Name: NF19009_low_86
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19009_low_86 |
 |  |
|
| [»] scaffold0136 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0136 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: scaffold0136
Description:
Target: scaffold0136; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 22 - 226
Target Start/End: Original strand, 16813 - 17017
Alignment:
| Q |
22 |
caggaaggtgaaagtgacatatttcatnnnnnnngagtatttgtttacatcaccagcaacataactgatgcacagcttggtgttcactgtagagagaaag |
121 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16813 |
caggaaggtgaaagtaacatatttcataaaaaaagagtatttgtttacatcaccagcaacataactgatgcacagcttggtgttcactgtagagagaaag |
16912 |
T |
 |
| Q |
122 |
ataatgatcttgggctacataacctaaattttggagaaacttatagcttttcatttaggcctgtaatctttatagaagcaaaattatacttttgtggata |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16913 |
ataatgatcttgggctacataacctaaattttggagaaacttatagcttttcatttaggcctgtaatctttatagaagcaaaattatacttttgtggatt |
17012 |
T |
 |
| Q |
222 |
ttctt |
226 |
Q |
| |
|
||||| |
|
|
| T |
17013 |
ttctt |
17017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 56 - 220
Target Start/End: Original strand, 34182106 - 34182270
Alignment:
| Q |
56 |
gagtatttgtttacatcaccagcaacataactgatgcacagcttggtgttcactgtagagagaaagataatgatcttgggctacataacctaaattttgg |
155 |
Q |
| |
|
|||||||||||||||| ||||||||| |||| ||| | |||| ||| ||||||| | ||| ||||| | |||| ||||| || | ||||| ||||| |
|
|
| T |
34182106 |
gagtatttgtttacattaccagcaacctaaccgataccgagctcggtcttcactgcaaagacaaagacactgattttgggtatcacacactaaaatttgg |
34182205 |
T |
 |
| Q |
156 |
agaaacttatagcttttcatttaggcctgtaatctttatagaagcaaaattatacttttgtggat |
220 |
Q |
| |
|
||||||||| || |||| ||||||||| |||||| |||||||| ||||||||||||| |||| |
|
|
| T |
34182206 |
agaaacttacagttttttttttaggcctaggatctttttagaagcagaattatacttttgcggat |
34182270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University