View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19009_low_92 (Length: 227)
Name: NF19009_low_92
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19009_low_92 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 128 - 180
Target Start/End: Complemental strand, 10094474 - 10094422
Alignment:
| Q |
128 |
tgaaaatagtaaaataaaaccatatattatattgtccaatgaacatcaatatg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| | ||||||||| |||||| |
|
|
| T |
10094474 |
tgaaaatagtaaaataaaaccatatattctattggcaaatgaacataaatatg |
10094422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University