View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19009_low_94 (Length: 216)
Name: NF19009_low_94
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19009_low_94 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 134 - 197
Target Start/End: Complemental strand, 27289061 - 27288998
Alignment:
| Q |
134 |
tttaactccttctactccttcaactcttcgctcaaattagttgaattatctaaccccccaaatg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27289061 |
tttaactccttctactccttcaactcttcgctcaaattagttgaattatctaaccccccaaatg |
27288998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 116
Target Start/End: Complemental strand, 26533878 - 26533837
Alignment:
| Q |
75 |
caaatgttagtatattagttgctatgtttgtattttctcctt |
116 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
26533878 |
caaatgttagtatattagttgttatgttagtattttctcctt |
26533837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 76 - 113
Target Start/End: Original strand, 28145719 - 28145756
Alignment:
| Q |
76 |
aaatgttagtatattagttgctatgtttgtattttctc |
113 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||| |
|
|
| T |
28145719 |
aaatgttagtatattagttgctatattagtattttctc |
28145756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 116
Target Start/End: Original strand, 30599082 - 30599122
Alignment:
| Q |
76 |
aaatgttagtatattagttgctatgtttgtattttctcctt |
116 |
Q |
| |
|
||||||||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
30599082 |
aaatgttagtatattggttgttatgttcgtattttctcctt |
30599122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 112
Target Start/End: Original strand, 3028561 - 3028597
Alignment:
| Q |
76 |
aaatgttagtatattagttgctatgtttgtattttct |
112 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
3028561 |
aaatgttagtatattagttgttatgttagtattttct |
3028597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University