View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19009_low_95 (Length: 215)

Name: NF19009_low_95
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19009_low_95
NF19009_low_95
[»] chr3 (1 HSPs)
chr3 (43-215)||(21720347-21720518)


Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 43 - 215
Target Start/End: Original strand, 21720347 - 21720518
Alignment:
43 ccctttctttattaacaccctaaaaacattgattcaacttagtaaagattgaaaaacaagacaagatgagtgtgattccaaaggaatcaattgaagtaat 142  Q
    ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21720347 ccctttctttattaacaccctaaaa-cattgattcaatttagtaaagattgaaaaacaagacaagatgagtgtgattccaaaggaatcaattgaagtaat 21720445  T
143 tgcacaaacccttggcatcaacaatttatcttccgatgttgcccttgctctttcacccgatcttgaatatcgc 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21720446 tgcacaaacccttggcatcaacaatttatcttccgatgttgcccttgctctttcacccgatcttgaatatcgc 21720518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University