View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19009_low_95 (Length: 215)
Name: NF19009_low_95
Description: NF19009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19009_low_95 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 43 - 215
Target Start/End: Original strand, 21720347 - 21720518
Alignment:
| Q |
43 |
ccctttctttattaacaccctaaaaacattgattcaacttagtaaagattgaaaaacaagacaagatgagtgtgattccaaaggaatcaattgaagtaat |
142 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21720347 |
ccctttctttattaacaccctaaaa-cattgattcaatttagtaaagattgaaaaacaagacaagatgagtgtgattccaaaggaatcaattgaagtaat |
21720445 |
T |
|
| Q |
143 |
tgcacaaacccttggcatcaacaatttatcttccgatgttgcccttgctctttcacccgatcttgaatatcgc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21720446 |
tgcacaaacccttggcatcaacaatttatcttccgatgttgcccttgctctttcacccgatcttgaatatcgc |
21720518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University