View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1900_high_21 (Length: 262)
Name: NF1900_high_21
Description: NF1900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1900_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 10 - 245
Target Start/End: Original strand, 32496799 - 32497040
Alignment:
| Q |
10 |
tgaacaaaatgatcataaaatacaatgcg------ttgtagattgaggaagaataccccgagccaccaaattatccttagtcagtaatctgttatggaga |
103 |
Q |
| |
|
||||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||| |
|
|
| T |
32496799 |
tgaacaaaatgatcataaaatgcaattcggctccgttgtagattgaggaagaataccccgagccaccaaattatccttagttgataatctatcatggaga |
32496898 |
T |
|
| Q |
104 |
agtctccaaacaaagattgaaacgttcgtaagaacctttctgtgccaaattaactctgatgtcggccatgcatgaaggttctcattggaagtgagtgact |
203 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
32496899 |
agtctccaagcaaagattgaaacgttggtaagaacctttctgtgccaaattaactctgatgtcagccatgcttgaaggttctcattagaagtgagtgact |
32496998 |
T |
|
| Q |
204 |
gttagactatactaactgggtaaccgccaacagaatccagct |
245 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32496999 |
gttaggctaaactaactgggtaaccgccaacagaatccagct |
32497040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University