View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1900_high_30 (Length: 240)
Name: NF1900_high_30
Description: NF1900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1900_high_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 4 - 225
Target Start/End: Original strand, 14550943 - 14551163
Alignment:
| Q |
4 |
gtcgatttatagggtccctctttggaaaagaaacctatcttattctcttgatagtagagtatagttttggttgggacatttgcttttgggaacaattttc |
103 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14550943 |
gtcgatttagagggtccctctttggaaaagaaacctatcttattctcttgatagtagagtatagttttggttgggacatttgcttttgggaacaattttc |
14551042 |
T |
|
| Q |
104 |
gtactcatgctactactggcatgttacaaggtcttcatttcacaaattaaatgtaaacatagtttaaataagtaaaatgtaatggtaaatttgaattcag |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14551043 |
gtactcatgctactactggcatgttacaaggtcttcatttcacaaattaaatgtaaacatagtttaaataagt-aaatgtaatggtaaatttgaattcag |
14551141 |
T |
|
| Q |
204 |
aaattgatggtatggtaaattg |
225 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
14551142 |
aaattgatggtatggtaaattg |
14551163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University