View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1900_high_31 (Length: 238)
Name: NF1900_high_31
Description: NF1900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1900_high_31 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 17112163 - 17111929
Alignment:
| Q |
17 |
ataagtaattcttgtctcaatgttgctaaagacattcatgatccagcaacaa--aacnnnnnnnnnnnnccagaaaggccatggagttgcaatgatagtt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
17112163 |
ataagtaattcttgtctcaatgttgctaaagacattcatgatccagcaacaacaaaaacaaaaaaaaaaccagaaaggccatggagttgcaatgatagtt |
17112064 |
T |
 |
| Q |
115 |
agaattg-----------tagagcaagaaatagagtccttcaataagaaaaatcaaatttagacacttttaaataccctaaaaattagatgatagttaaa |
203 |
Q |
| |
|
||||||| |||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17112063 |
agaattggttacaaattgtagagcaataaatagagtccttgaataagaagaatcaaatttagacacttttaaataccctacaaattagatgatagttaaa |
17111964 |
T |
 |
| Q |
204 |
tgcaagttaatttataagaaaaaggaaggtaggtc |
238 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17111963 |
tgcaaattaatttataagaaaaaggaaggtaggtc |
17111929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University