View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1900_high_35 (Length: 225)
Name: NF1900_high_35
Description: NF1900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1900_high_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 82 - 212
Target Start/End: Complemental strand, 37179265 - 37179135
Alignment:
| Q |
82 |
atgtttgtcaagaattaccaaccgccgacttcaatttagagtgttttctggaacaattttggagtttcagacacaattacattattgttatctcattcca |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37179265 |
atgtttgtcaagaattaccaaccgccgacttcaatttagagtgttttctggaacaattttggagtttcagacacaattacattattgttgtctcattcca |
37179166 |
T |
 |
| Q |
182 |
ttactagtttataggatttattttagctgat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37179165 |
ttactagtttataggatttattttagctgat |
37179135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University