View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1900_high_4 (Length: 511)
Name: NF1900_high_4
Description: NF1900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1900_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 3e-55; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 9 - 136
Target Start/End: Original strand, 11625156 - 11625280
Alignment:
| Q |
9 |
gataattctgattcgaagatgaaaagggtggtgtaataaacagaaataataaaagaaaatgtttgtgagtggattgattcattgactgtatattagaata |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11625156 |
gataattctgattcgaagatgaaaagggtggtgtaataaacagaaata---aaagaaaatgtttgtgagtggattgattcattgactgtatattagaata |
11625252 |
T |
|
| Q |
109 |
ttggacgtcattttcactgactacaaat |
136 |
Q |
| |
|
|||||||||||||||||||||| ||||| |
|
|
| T |
11625253 |
ttggacgtcattttcactgacttcaaat |
11625280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 273 - 333
Target Start/End: Original strand, 11626194 - 11626254
Alignment:
| Q |
273 |
tgcactgttcattgttaatgtgtgacgattgaattgtatgtctttcttccatctagttata |
333 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11626194 |
tgcactgttcattgttaatgtttgatgattgaattgtatgtctttcttccatctagttata |
11626254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 455 - 493
Target Start/End: Original strand, 11626372 - 11626410
Alignment:
| Q |
455 |
atttggtttttggtatgagagtcacaaattcttcaatca |
493 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11626372 |
atttggtttttggtatgagagtcacaaattcttcaatca |
11626410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 184 - 219
Target Start/End: Original strand, 11626090 - 11626125
Alignment:
| Q |
184 |
ttgggattctcacttcttccggtttctcaaggtgtg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
11626090 |
ttgggattctcacttcttccggtttctcaaggtgtg |
11626125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 132 - 170
Target Start/End: Original strand, 11626040 - 11626078
Alignment:
| Q |
132 |
caaatacttagggaagtggaaatgctgaggcattcttaa |
170 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
11626040 |
caaatacttagtgaagtggaaatgctgagacattcttaa |
11626078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University