View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1900_high_8 (Length: 457)
Name: NF1900_high_8
Description: NF1900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1900_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 51; Significance: 5e-20; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 29 - 110
Target Start/End: Complemental strand, 6913866 - 6913784
Alignment:
| Q |
29 |
gtagagatcgttggtgttgataaa-tactaataaaacttttctcatgaatcatgtttttgtaacagaactcggttttccacaa |
110 |
Q |
| |
|
||||||||||||||| |||||||| |||||||| ||| ||||||||||||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
6913866 |
gtagagatcgttggttttgataaaatactaatacaacatttctcatgaatcatgtttttgtaaaataactcagttttccacaa |
6913784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 135 - 174
Target Start/End: Complemental strand, 6913738 - 6913699
Alignment:
| Q |
135 |
ctgataattttattttctagaacatctctcgtttccaacc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6913738 |
ctgataattttattttctagaacatctctcgtttccaacc |
6913699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 384
Target Start/End: Original strand, 39850507 - 39850540
Alignment:
| Q |
351 |
cgaatcggttcgtgcgaaccaattcgcggttctc |
384 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
39850507 |
cgaatcggttcgcgcgaaccaattcgcggttctc |
39850540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University