View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1900_low_27 (Length: 262)

Name: NF1900_low_27
Description: NF1900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1900_low_27
NF1900_low_27
[»] chr1 (1 HSPs)
chr1 (10-245)||(32496799-32497040)


Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 10 - 245
Target Start/End: Original strand, 32496799 - 32497040
Alignment:
10 tgaacaaaatgatcataaaatacaatgcg------ttgtagattgaggaagaataccccgagccaccaaattatccttagtcagtaatctgttatggaga 103  Q
    ||||||||||||||||||||| |||| ||      ||||||||||||||||||||||||||||||||||||||||||||||   |||||| | |||||||    
32496799 tgaacaaaatgatcataaaatgcaattcggctccgttgtagattgaggaagaataccccgagccaccaaattatccttagttgataatctatcatggaga 32496898  T
104 agtctccaaacaaagattgaaacgttcgtaagaacctttctgtgccaaattaactctgatgtcggccatgcatgaaggttctcattggaagtgagtgact 203  Q
    ||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||||||||||    
32496899 agtctccaagcaaagattgaaacgttggtaagaacctttctgtgccaaattaactctgatgtcagccatgcttgaaggttctcattagaagtgagtgact 32496998  T
204 gttagactatactaactgggtaaccgccaacagaatccagct 245  Q
    ||||| ||| ||||||||||||||||||||||||||||||||    
32496999 gttaggctaaactaactgggtaaccgccaacagaatccagct 32497040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University