View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1900_low_29 (Length: 250)
Name: NF1900_low_29
Description: NF1900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1900_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 119 - 234
Target Start/End: Original strand, 52035632 - 52035747
Alignment:
| Q |
119 |
tttttaaaaaagtgtcattttttagagaatgaaataaataaagtagctaaaatttaatacacactcattgcatcgttttgtcaatattgtgatcaaaagc |
218 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035632 |
tttttacaaaagtgtcattttttagagaatgaaataaataaagtagctaaaatttaatacacactcattgcatcgttttgtcaatattgtgatcaaaagc |
52035731 |
T |
 |
| Q |
219 |
atctcatgtcattttt |
234 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
52035732 |
atctcatgtcattttt |
52035747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 38 - 89
Target Start/End: Original strand, 52035590 - 52035641
Alignment:
| Q |
38 |
gatacgaataatatgctttttctttcacaatctttcattcaatttttacaaa |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035590 |
gatacgaataatatgctttttctttcacaatctttcattcaatttttacaaa |
52035641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University