View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1900_low_34 (Length: 245)
Name: NF1900_low_34
Description: NF1900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1900_low_34 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 21 - 245
Target Start/End: Original strand, 29672327 - 29672551
Alignment:
| Q |
21 |
attgaaataaaccaaaccagcgttagcaacacccattcagtgggtcccatcaacaagcccacagaggctacgagcatagtaaagtgctaaacgtgctatg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29672327 |
attgaaataaaccaaaccagcgttagcaacacccattccgtgggtcccatcaacaagcccacagaggctacgagcatagtaaagtgctaaacgtgctatg |
29672426 |
T |
|
| Q |
121 |
cctgaatgaccatgaagttcacctatggcttttggaaaaacgggccgacccagggctttttcttgggccaaacggtgggtttcggtgaagcggcaagagt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29672427 |
cctgaatgaccatgaagttcacctatggcttttggaaaaacgggccggcccagggctttttcttgggccaaacggtgggtttcggtgaagcggcaagagt |
29672526 |
T |
|
| Q |
221 |
aactgacggagccgtttgtgaattt |
245 |
Q |
| |
|
|||| |||||||||||||||||||| |
|
|
| T |
29672527 |
aacttacggagccgtttgtgaattt |
29672551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University