View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1900_low_42 (Length: 225)

Name: NF1900_low_42
Description: NF1900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1900_low_42
NF1900_low_42
[»] chr8 (1 HSPs)
chr8 (82-212)||(37179135-37179265)


Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 82 - 212
Target Start/End: Complemental strand, 37179265 - 37179135
Alignment:
82 atgtttgtcaagaattaccaaccgccgacttcaatttagagtgttttctggaacaattttggagtttcagacacaattacattattgttatctcattcca 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
37179265 atgtttgtcaagaattaccaaccgccgacttcaatttagagtgttttctggaacaattttggagtttcagacacaattacattattgttgtctcattcca 37179166  T
182 ttactagtttataggatttattttagctgat 212  Q
    |||||||||||||||||||||||||||||||    
37179165 ttactagtttataggatttattttagctgat 37179135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University