View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1900_low_43 (Length: 216)

Name: NF1900_low_43

Description: NF1900

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1900_low_43

[»] chr3 (1 HSPs)

[»] chr6 (1 HSPs)

Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 1)

Name: chr3

Description:

Target: chr3; HSP #1

Raw Score: 81; E-Value: 3e-38

Query Start/End: Original strand, 13 - 190

Target Start/End: Complemental strand, 33150339 - 33150161

Alignment:

Q	13	gatgaatatggaagagataagaaagtggctggtggggttgccaaagggggctgaacagcggtgttatggtggactggaagttggtggtgnnnnnnnngaa	112	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|
T	33150339	gatgaatatggaagagataagaaagtgggtggtggggttgccaaagggggctgaacaacggtgttatggt-gactggaagttggtggtgaaaaaaa--aa	33150243	T

Q	113	ggaaaaagaagatacgtagagtgaca----nnnnnnnngttcttctaatttctcttacctcccttacaaatatacaattttg	190	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	33150242	ggaaaaagaagatacgtaaagtgacatgtttttttttccttcttctaatttctcttacctcccatacaaatatacaattttg	33150161	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)

Name: chr6

Description:

Target: chr6; HSP #1

Raw Score: 32; E-Value: 0.000000005

Query Start/End: Original strand, 151 - 194

Target Start/End: Original strand, 28928757 - 28928800

Alignment:

Q	151	ttctaatttctcttacctcccttacaaatatacaattttggatt	194	Q
		\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	28928757	ttctaatgtctcttacctcccttgcaaaaatacaattttggatt	28928800	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]